Anti craf antibody

Manufactured by Cell Signaling Technology

Anti-CRAF antibody is a tool used to detect and analyze the CRAF protein, a kinase involved in cellular signaling pathways. This antibody can be used in various laboratory techniques to identify and quantify CRAF expression levels.

Automatically generated - may contain errors

Lab products found in correlation

Anti myc antibody, by Thermo Fisher Scientific (1 mentions) Anti flag antibody, by Merck Group (1 mentions) N myc tagged pmxs puro retroviral vector, by Cell Biolabs (1 mentions) N terminal myc or flag tag, by Thermo Fisher Scientific (1 mentions) Chir99021, by Merck Group (1 mentions) Anti phospho p44 42 mapk erk1 2, by Cell Signaling Technology (1 mentions) Recombinant human egf, by Merck Group (1 mentions) Anti ras antibody, by Cell Signaling Technology (1 mentions) Anti p44 42 mapk erk1 2 antibody, by Cell Signaling Technology (1 mentions) Anti phospho p44 42 mapk erk1 2 thr202 tyr204 antibody, by Cell Signaling Technology (1 mentions) Anti mek1 2 antibody, by Cell Signaling Technology (1 mentions) Anti phospho mek1 2 ser217 221 antibody, by Cell Signaling Technology (1 mentions) Pvdf membrane, by Merck Group (1 mentions) Clarity western ecl substrate, by Bio-Rad (1 mentions) Immobilon western chemiluminescent hrp substrate, by Merck Group (1 mentions) Anti β actin antibody, by Merck Group (1 mentions)

3 protocols using anti craf antibody

Generation and Characterization of RAF1 Fusion Constructs

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

SRGAP3-RAF1 and QKI-RAF1 constructs were synthesized as Gateway compatible entry clones. Full-length RAF1, QKI and SRGAP3 were purchased as gateway entry clones from PlasmID/Dana-Farber/Harvard Cancer Center DNA Resource Core. Sub-cloning was done to integrate SRGAP3-RAF1, QKI-RAF1, full-length QKI, RAF1 and SRGAP3 into Gateway-compatible N-MYC-tagged pMXs-Puro Retroviral Vector (Cell Biolabs). NIH3T3 and early-passage PMAs were transduced using infection protocol previously described^{18 (link)}. Gateway destination vectors with either an N-terminal MYC or FLAG tag (Invitrogen) were generated for all constructs. Anti-MYC antibody (Invitrogen R951-25, 1:5000) and anti-FLAG antibody (Sigma A8592, 1:10,000) were used to detect tagged-proteins along with anti-CRAF antibody (Cell Signaling #9422).
QKI-RAF1 dimerization mutants were generated by PCR-based site-directed mutagenesis of MYC- and FLAG-tagged constructs. RAF^R401H dimerization mutants^{35 (link), 36 (link)} in QKI-RAF1 were generated using primers: Forward CGCAAAACACACCATGTGAACA and Reverse CAGAACAGCCACCTCATTCCT. QKI^E48G dimerization mutants^{31 (link)} in QKI-RAF1 were generated using primers: Forward CTGGACGAAGGAATTAGCAGAG and Reverse CAGCCGCTCGAGGTGGTT.

Jain P., Fierst T.M., Han H.J., Smith T.E., Vakil A., Storm P.B., Resnick A.C, & Waanders A.J. (2017). CRAF gene fusions in pediatric low-grade gliomas define a distinct drug response based on dimerization profiles. Oncogene, 36(45), 6348-6358.

+ Open protocol

+ Expand

Western Blot Antibody Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were purchased from Cell Signaling Technologies: anti-Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (E10) Mouse mAb #9106, anti-histone H3 (D1H2) XP Rabbit mAb #4499, anti-c-Raf Antibody #9422, anti-phospho-LRP6 (Ser1490) Antibody #2568, anti-GAPDH (D4C6R) Mouse mAb #97166. Anti-Beta-catenin mouse mAb was purchased from BD Transduction Laboratories (#610153) and anti-GAPDH rabbit antibody was purchased from Abcam (ab9485). The following fluorescent secondary antibodies were purchased from Fisher Scientific: IRDye 800CW Goat anti-Mouse IgG (926–32210) and IRDye 680LT Goat anti-Rabbit IgG (926-68021).
Recombinant human Wnt3A was purchased from Fisher Scientific (5036WN), and recombinant human EGF was purchased from Sigma (E9644). CHIR99021 was purchased from Sigma (SML1046). Halt Protease and Phosphatase Inhibitor Cocktail (100X) was purchased from Fisher Scientific (78440).

Nunns H, & Goentoro L. (2018). Signaling pathways as linear transmitters. eLife, 7, e33617.

+ Open protocol

+ Expand

Western Blot Analysis of MAPK Signaling Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed with SDS lysis buffer (0.1 M Tris‐HCl at pH 8.0, 10% glycerol, 1% SDS) and immediately boiled for 10 minutes to obtain clear lysates. Protein concentrations were measured using the BCA method (Pierce). Lysates containing equal amounts of proteins were separated by SDS‐PAGE and transferred to PVDF membranes (Merck) for Western blot analysis using the appropriate antibodies. Immunoreactive proteins were visualized using the Immobilon Western chemiluminescent HRP substrate (Merck) or Clarity Western ECL substrate (Bio‐Rad); light emission intensity was quantified using an LAS‐3000 lumino‐image analyzer equipped with Image Gauge v2.3 software. The antibodies used in this study were: anti‐BRAF antibody (14814; Cell Signaling Technology), anti‐CRAF antibody (53745; Cell Signaling Technology), anti‐MEK1/2 antibody (8727; Cell Signaling Technology), anti‐phospho‐MEK1/2 (Ser217/221) antibody (9121; Cell Signaling Technology), anti‐p44/42 MAPK (ERK1/2) antibody (4695; Cell Signaling Technology), anti‐phospho‐p44/42 MAPK (ERK1/2) (Thr202/Tyr204) antibody (4377; Cell Signaling Technology), anti‐RAS antibody (8955; Cell Signaling Technology), anti‐CRBN antibody (71810; Cell Signaling Technology), and anti‐β‐actin antibody (A5316; Merck).

Ohoka N., Suzuki M., Uchida T., Tsukumo Y., Yoshida M., Inoue T., Ohki H, & Naito M. (2022). Development of a potent small‐molecule degrader against oncogenic BRAFV600E protein that evades paradoxical MAPK activation. Cancer Science, 113(8), 2828-2838.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!