Mircury lna mirna pcr assay kit

Injured spinal cords 500 μm rostral and 300 μm caudal to the lesion from 7-10 control or miR-200a inhibitor electroporated animals were micro-dissected and pooled for each biological replicate. Total RNA was isolated using Trizol (Invitrogen) according to the manufacturer's instructions. Subsequent cDNA was synthesized from 1 μg of DNaseI (NEB) treated RNA using either High Capacity cDNA Reverse Transcription kit (Applied Biosystems) or miRCURY LNA RT Kit (Qiagen). The qRT-PCR was carried out using Light Cycler 480 SYBR Green I Master (Roche). MicroRNA qRT-PCR was carried out with custom designed LNA primers to conserved miRNAs using the miRCURY LNA miRNA PCR Assay kit (Qiagen) and custom primers from IDT were used to quantify axolotl mRNAs: 18S_F, CGGCTTAATTTGACTCAACACG; 18S_R, TTAGCATGCCAGAGTCTCGTTC; brachyury_F, GAAGTATGTCAACGGGGAAT; brachyury_R, TTGTTGGTGAGCTTGACTTT; sox2_F, TTGTGCAAAATGTGTTTCCA; sox2_R, CATGTTGCTTCGCTTTAGAA; wnt3a_F, AAGACATGCTGGTGGTCTCA; wnt3a_R, CCCGTACGCATTCTTGACAG; wnt5a_F, ACCCTGTTCAAATCCCGGAG; wnt5a_R, GGTCTTTGCCCCTTCTCCAA; wnt8a_F, TTGCTGTCAAATCAACCATG; wnt8a_R, TGCCTATATCCCTGAACTCT; ctnnb1_F, ACCTTACAGATCAAAGCCAG; ctnnb1_R, GGACAAGTGTTCCAAGAAGA; lef1_F, GTCCCACAACTCCTACCACA; lef1_R, TAGGGGTCGCTGTTCACATT; fgf8_F, TTTGTCCTCTGCATGCAAGC; fgf8_R, GTCTCGGCTCCTTTAATGCG; fgf10_F, AAACTGAAGGAGCGGATGGA; fgf10_R, TCGATCTGCATGGGAAGGAA.

For miRNAs, cDNA was synthesized from 50 ng of total RNA using miRCURY LNA RT Kit (Qiagen, Hilden, Germany), and miRNA expression levels were determined by qRT-PCR analysis using the miRCURY LNA miRNA PCR Assay kit (Qiagen, Hilden, Germany). All reactions were performed in triplicate and the results were normalized with U6 or other reference genes RNU48, and 5S. Amplification was performed using a reaction cycle at 95°C for 2 min, 95°C for 10 s, and 56°C for 1 min. For Nr3c1 expression, qRT-PCR analysis was performed using TB Green^® Premix Ex Taq^™ (Takara Bio Inc., Kusatsu, Shiga, Japan) and the results were normalized with β-actin. Amplification was performed using a reaction cycle at 95°C for 30 s, 95°C for 5 s, and 60°C for 30 s. The fluorescence signal was detected at the end of the cycle using LightCycler^® 480 II (Roche, Basel, Switzerland). Following amplification, melting curve or dissociation curve analysis was performed to measure the specificity of the PCR product. The temperature program used for the melting curve analysis was 95°C for 15 s followed by 60°C for 1 m and then 95 for 15 s with a ramp rate of +0.3°C/s. The relative expression was calculated using the 2^−ΔΔCt method, where Ct is the threshold cycle.

Total RNA of tissues or cells was isolated using Trizol reagent (Takara, Dalian, China). RNA was reversely transcribed into cDNA using the QuantiTect Reverse Transcription Kit from Qiagen (Hilden, German). Quantitative PCR analysis was performed using the SYBR Premix Ex Taq II (Takara). The primer sequences are shown in Supplementary Table S1. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a normalization control. Quantification of miRNAs was conducted using the miRCURY LNA miRNA PCR Assay kit (Qiagen), according to the manufacturer’s instructions. The relative expression of miRNAs was normalized against U6 expression.
To identify the lncRNAs that mediate the tumor-promoting activity of MKL1, we performed lncRNA PCR array assays in MKL1-overexpressing NSCLC cells. The lncRNA PCR array included 84 key lncRNAs involved in cancer cell proliferation, survival, migration, and invasion. Quantitative PCR was conducted as described above. Expression of each lncRNA was normalized to the average value of 5 housekeeping genes. Results are expressed as fold change relative to the vector group.