Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Hypaque density gradient centrifugation (Ficoll-Hypaque; TBDScience, Tianjin, China). Total RNA was extracted from PBMC with TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The first-strand cDNA was synthesized using the Reagent Kit (TaKaRa, Dalian, China). The primers and probes for real-time PCR of IRAK1 were purchased from QuantiFast Probe of Qiagen. The sense and antisense primers of IRAK4 used in this experiment were: sense: 5′TGATGGAGATGACCTCTGCT3′ and antisense: 5′GGTGGAGTACCATCCAAGCAA3′. Real-time quantitative PCR was performed on an AB7500 Fast System (Applied Biosystems). During the course of the project we first tested IRAK1 expression and later also included IRAK4 in a different set of patients and controls.
Ab 7500 fast system
Manufactured by Thermo Fisher Scientific
Sourced in Switzerland, United States
The AB 7500 Fast System is a real-time PCR instrument designed for fast and accurate nucleic acid quantification. It features a compact design, a high-performance optical system, and fast thermal cycling capabilities to enable efficient genetic analysis workflows.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 3 reverse transcriptase system, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Roche (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Taqman probe, by Thermo Fisher Scientific (2 mentions)
Random hexamer, by Thermo Fisher Scientific (2 mentions)
Ficoll hypaque, by TBD Science (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Taqman multiplex master mix, by Thermo Fisher Scientific (1 mentions)
Clear seal diamond heat sealing film, by Thermo Fisher Scientific (1 mentions)
Revertaid reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Mammalian total rna miniprep kit, by Merck Group (1 mentions)
Geneamp pcr system 9700, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Dntps, by Promega (1 mentions)
6 protocols using ab 7500 fast system
1
PBMC Isolation and IRAK Gene Expression
2
Quantifying Th17 Cell Markers via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Life Technologies, Grand Island, NY, USA) was used to extract total RNA from stimulated CD4+ T cells according to the manufacturer’s instructions. The Superscript III Reverse Transcriptase system was then used for cDNA reverse transcription (Invitrogen). RT-qPCR was carried out using the AB 7500 Fast System (Applied Biosystems, Foster City, CA) after the addition of SYBR Green Master Mix (Roche, Basel, Switzerland). The following primer sequences were used: mouse IL-17A, forward 5′-TTTTCAGCAAGGAATGTGGA-3′ and reverse 5′-TTCATTGTGGAGGGCAGAC-3′; mouse RORγt, forward 5′-CCGCTGAGAGGGCTTCAC-3′ and reverse 5′-TGCAGGAGTAGGCCACATTACA-3′; and mouse GAPDH, forward 5′-GGCATCCTGGGCTACACTGA-3′ and reverse 5′-GGAGTGGGTGTCGCTGTTG-3′.
3
Th17 Cell Differentiation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CD4 T cells were incubated in 96-well plates (5 × 104/well) for 72 h under Th17-polarizing conditions with or without alantolactone. Total RNA was prepared from stimulated CD4 T cells using TRIzol reagent (Invitrogen, Rockville, MD). cDNA was synthesized for each RNA sample with a Superscript III Reverse Transcriptase system (Invitrogen, Carlsbad, CA). Real-time quantitative gene expression was determined with the AB 7500 Fast System (Applied Biosystems, Foster City, CA) using SYBR Green Master Mix (Roche, Basel, Switzerland). The 2–ΔΔCT method was used to normalize transcription against GAPDH, and induction relative to controls was calculated as fold changes. Table 1 shows the primer pair sequences used for real-time PCR.
4
Molecular Detection of Plasmodium falciparum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from dried blood samples collected onto a filter paper. Blood spots were punched with a sterile hole puncher. DNA was extracted using a PureLink Pro 96 well Genomic DNA kit following the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Plasmodium falciparum species–specific qPCR was performed in duplicates, using 5 µL of samples DNA, forward (5′-GTAATT GGA ATG ATA GGA ATT TAC AAG GT-3′) and reverse (5′-TCA artemisinin-based combination therapy (ACT) ACG AAC GTT TTA ACT GCA AC-3′) primers, CYS5-FAM probe, and TaqMan™ Multiplex Master Mix (Thermo Fisher Scientific, Waltham, MA). Quantitative PCR was performed in 96-well plate on the AB 7500 FAST system (Applied Biosystems, Foster City, CA). The first WHO international standard for nucleic-acid amplification test (NAT) analysis was used as qPCR control in a form of a standard curve.9 (link)
5
Quantification of mRNA Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Part of the total RNA (40 ng) from each sample was subjected to cDNA synthesis using RevertAid Reverse Transcriptase Kit (Thermo Fisher Scientific, Darmstadt, Germany). Quantitative Real Time PCR (qRT-PCR) was performed using TaqMan Gene Expression Assays in Applied Biosystems 96-well PCR plates (Thermo Fisher Scientific). Plates were sealed with Clear Seal Diamond Heat Sealing Film (Thermo Fisher Scientific) and run in an AB7500 fast system (Applied Biosystems, Thermo Fisher Scientific, Foster City, CA, United States). TaqMan probes (Thermo Fisher Scientific) were used to quantify transcripts of hypoxanthine phosphoribosyltransferase 1 (HPRT, Mm03024075_m1), matrix metalloproteinase 9 (MMP9, Mm00442991_m1) and tissue inhibitor of metalloproteinases 1 (TIMP1, Mm01341361_m1).
6
Quantifying Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed using the Mammalian Total RNA Miniprep kit (Sigma) according to the manufacturer's protocol and quantified using the NanoDrop system. A total of 1 μg of RNA was reversetranscribed using 0.5 μg random hexamers (Thermo Scientific), 0.5 mM dNTPs (Promega, Wisconsin, United States) and 200 U M-MLV reverse transcriptase (Promega) using the GeneAmp PCR System 9700 (Applied Biosystems, Thermo Fisher Scientific, Massachusetts, United States). Gene expression changes were determined by SYBR Green qPCR using the AB7500 Fast system (Applied Biosystems). Primers sequences used were as follows: Tensin 3 (F) GTTGAAAGGGTGCTCGAATGA, Tensin 3 (R) GAACTTTCTGCTATTTCCTCCAATG (Cao et al. 2012) , HPRT (F) AAATTCTTTGCTGACCTGCT, HPRT (R) TCCCCTGTTGACTGGTCATT, Cten (F) GCGTCTGCTCAGAATCGAC and Cten (R) GATGAGGAAGTGTCGGATGAG. The run cycle comprised a hold stage at 95°C for 2 min, cycling stage 40X (95°C for 3 s, annealing temperature for 30 s) and a melt curve stage 95°C for 15 s, 50°C for 1 min, 95°C for 15 s, 95°C for 15 s and 50°C for 15 s. Reactions were determined as having similar efficiencies, and the ΔΔCt method was used for gene quantification.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!