Alt kit

Manufactured by Nanjing Jiancheng

Sourced in China

The ALT Kit is a laboratory equipment designed for the measurement of alanine aminotransferase (ALT) levels. ALT is an enzyme found in the liver and its measurement is used as an indicator of liver function. The ALT Kit provides the necessary reagents and materials to perform this specific test in a laboratory setting.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

ALT and AST detection kits Assay kits for ALT Detection kits of ALT ALT and AST activity assay kits AST and ALT assay kits ALT and AST kits ALT assay kit (C009-2-1) GPT/ALT kit ALT and AST assay kits ALT colorimetric assay kit

9 protocols using alt kit

Serum ALT and AST Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The serum levels of Alanine aminotransferase (ALT) and Alanine aminotransferase (AST) were determined by using ALT kit (Nanjing Jiancheng Biotechnology, #C009-2-1) and AST kit (Nanjing Jiancheng Biotechnology, #C010-2-1) respectively.

Zhen Q., Liang Q., Wang H., Zheng Y., Lu Z., Bian C., Zhao X, & Guo X. (2023). Theabrownin ameliorates liver inflammation, oxidative stress, and fibrosis in MCD diet-fed C57BL/6J mice. Frontiers in Endocrinology, 14, 1118925.

+ Open protocol

+ Expand

Liver Function Biomarker Measurement

Check if the same lab product or an alternative is used in the 5 most similar protocols

Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin, and glutathione (GSH) were measured following the protocol of an ALT kit (Cat# C009-1-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China), AST kit (Cat# C010-1-1, Nanjing Jiancheng Bioengineering Institute), albumin kit (Cat# A028-1-1, Nanjing Jiancheng Bioengineering Institute), and GSH assay kit (Cat# A006-1-1, Nanjing Jiancheng Bioengineering Institute), respectively. The optical densities were measured with a Synergy 2 multi-mode microplate reader (Agilent Technologies, Inc.). Each sample was measured three times, and the average absorbance values were calculated for every sample. The concentrations in the samples were determined using the standard curves.

Jiang H., Zhang X., Yang W., Li M., Wang G, & Luo Q. (2022). Ferrostatin-1 Ameliorates Liver Dysfunction via Reducing Iron in Thioacetamide-induced Acute Liver Injury in Mice. Frontiers in Pharmacology, 13, 869794.

+ Open protocol

+ Expand

Plasma Metabolite Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood samples were obtained from the inferior vena cava and were centrifugated at 3,000 rpm for 5 min to obtain plasma. Plasma levels of triglyceride (TG), total cholesterol (TC), alanine transaminase (ALT), aspartate transaminase (AST), amylase, creatinine, and urea nitrogen were analyzed by Triglyceride kit, Total cholesterol kit (Kehua, Shanghai, China), AST kit, ALT kit, amylase kit, creatinine kit, and urea nitrogen kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) respectively according to the manufacturer’s instruction.

Yao Q., Li S., Cheng X., Zou Y., Shen Y, & Zhang S. (2020). Yin Zhi Huang, a traditional Chinese herbal formula, ameliorates diet-induced obesity and hepatic steatosis by activating the AMPK/SREBP-1 and the AMPK/ACC/CPT1A pathways. Annals of Translational Medicine, 8(5), 231.

+ Open protocol

+ Expand

Liver Function Biomarker Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The serum levels of alanine aminotransferase (ALT), albumin (ALB), aspartate aminotransferase (AST) and Total Bilirubin (TBIL) were detected by ALT Kit (#C009-2-1, Jiancheng, China), ALB Kit (#A028-2-1, Jiancheng, China), AST Kit (#C010-2-1, Jiancheng, China) and TBIL (#C019-1-1, Jiancheng, China)following the manufacturer’s directions.

Peng X., Yang H., Tao L., Xiao J., Zeng Y., Shen Y., Yu X., Zhu F, & Qin J. (2023). Fluorofenidone alleviates liver fibrosis by inhibiting hepatic stellate cell autophagy via the TGF-β1/Smad pathway: implications for liver cancer. PeerJ, 11, e16060.

+ Open protocol

+ Expand

Serum Enzyme Measurement Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Serum samples were separated from whole blood by centrifugation. Then, serum ALT and AST were measured using ALT Kit and AST Kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Lang Z., Zhang R., Li X., Jin Y., Hu Y., Lin X., Tang Y., Zhang J., Zheng L., Yu Z, & Zheng J. (2023). GAS5-inhibited hepatocyte pyroptosis contributes to hepatic stellate cell inactivation via microRNA-684 and AHR. iScience, 26(8), 107326.

+ Open protocol

+ Expand

HBV Viral Load and Biomarkers Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood was collected immediately when mice killed, and serum was prepared for detection. HBV DNA copies were quantified by real‐time PCR (Qiagen, Germany). ALT level was detected by ALT Kit (Nanjing Jiancheng Bioengineering Institute, China). HBsAg was quantified by Diagnostic Kit for HBsAg (ELISA) (InTec Products, INC, XIAMEN, China), and standard curve of HBsAg was made using standards from ProSpec‐Tany TechnoGene Ltd., Israel. IFN‐γ or TNF‐α level was detected using ELISA kit from DAKEWE, China. Mouse livers were also used to extract tissue RNA. The expression of viral pgRNA was measured or quantified by PCR or real‐time PCR (primer sequences: 5′‐3′ CTCAATCTCGGGAATCTCAATGT/AGGATAGAACCTAGCAGGCATAAT; products: 231 base pairs).29

Xu Y., Wang Z., Du X., Liu Y., Song X., Wang T., Tan S., Liang X., Gao L, & Ma C. (2018). Tim‐3 blockade promotes iNKT cell function to inhibit HBV replication. Journal of Cellular and Molecular Medicine, 22(6), 3192-3201.

+ Open protocol

+ Expand

Quantification of Liver Enzyme and Oxidative Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

Blood samples were collected after letting them stand at ambient temperature for at least 30 min and centrifuged at 3000 rpm for 15 min. Expression levels of alanine aminotransferase (ALT) were measured by ALT kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China, C009-2-1), and those of aspartate aminotransferase (AST) were measured by AST kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China, C010-2-1). Malondialdehyde (MDA) and superoxide dismutase (SOD) activities were detected using MDA (Shanghai Lanchu Biotechnology Co., Ltd., E-BC-K025-M) and SOD (Shanghai Lanchu Biotechnology Co., Ltd., E-BC-K022-M) assay kits, respectively. All the experimental manipulations were performed according to the manufacturer’s procedure.

Jiang H., Shang Z., You L., Zhang J., Jiao J., Qian Y., Lin J., Wang F., Gao Y., Kong X, & Sun X. (2023). Electroacupuncture Pretreatment at Zusanli (ST36) Ameliorates Hepatic Ischemia/Reperfusion Injury in Mice by Reducing Oxidative Stress via Activating Vagus Nerve-Dependent Nrf2 Pathway. Journal of Inflammation Research, 16, 1595-1610.

+ Open protocol

+ Expand

Hepatoprotective Compounds Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols

The compounds tested, with a purity of >98%, were purchased from Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Additionally, a-naphthylisothiocyanate (ANIT), OCA, and CDCA with a purity of >98% were purchased from Sigma-Aldrich Chemical Co., Ltd. (Darmstadt, Germany). The dual-luciferase reporter assay kit was procured from Promega (Madison, United States), while the ALT Kit, AST Kit, ALP Kit, and TBA Kit were obtained from Nanjing Jiancheng Institute of Biotechnology (Nanjing, China). Furthermore, the RNAprep Pure Tissue Kit and FastQuant RT Kit were purchased from TIANGEN Biotech Co., Ltd. (Beijing, China), and the FastStart Essential DNA Green Master Kit was acquired from Roche.

Xi L., Shi A., Shen T., Wang G., Wei Y, & Guo J. (2023). Licraside as novel potent FXR agonist for relieving cholestasis: structure-based drug discovery and biological evaluation studies. Frontiers in Pharmacology, 14, 1197856.

+ Open protocol

+ Expand

Serum Levels of ALT, AST, and HYP

Check if the same lab product or an alternative is used in the 5 most similar protocols

The levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and hydroxyproline (HYP) in serum were assessed using ALT Kit (#C009‐2–1, Jiancheng, China), AST Kit (#C010‐2–1, Jiancheng, China) and HYP Kit (#A030‐2–1, Jiancheng, China) according to manufacturer's instructions.

Yuan S., Wei C., Liu G., Zhang L., Li J., Li L., Cai S, & Fang L. (2021). Sorafenib attenuates liver fibrosis by triggering hepatic stellate cell ferroptosis via HIF‐1α/SLC7A11 pathway. Cell Proliferation, 55(1), e13158.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!