Total RNA from rat brain tissue was extracted by a total RNA extraction kit (R1200, Solarbio, China). Total RNA was reverse transcribed into cDNA with the help of a reverse transcription kit (CW2569, cwbiotech, China). Then the SYBR Green qPCR kit (CW2601, cwbiotech, China) was used for qPCR. β-actin was employed as an internal control. The primers were listed as follows: BDNF, forward: 5′- GGCAGGCTTTGATGAGACCG-3′ and reverse: 5′-TCACCTGGTGGAACTCAGGGT-3′; β-actin, forward: 5′-AACCTTCTTGCAGCTCCTCC-3′ and reverse: 5′-TACCCACCATCACACCCTGG-3′. Relative expressions of BDNF were analyzed by a Real-Time PCR Detection system (CFX96, Bio-rad, USA) with the 2-ΔΔCt method [26 (link)].
Sybr green qpcr kit
Manufactured by CWBIO
Sourced in China
The SYBR Green qPCR kit is a laboratory tool designed for real-time quantitative PCR (qPCR) analysis. It contains SYBR Green, a fluorescent dye that binds to double-stranded DNA, enabling the detection and quantification of DNA targets during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Cw2569, by CWBIO (2 mentions)
Reverse transcription kit, by CWBIO (2 mentions)
Cfx96, by Bio-Rad (1 mentions)
Total rna extraction kit, by Solarbio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rnaprep pure plant kit, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Prism 7, by GraphPad (1 mentions)
Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Cdna reverse transcription kit, by CWBIO (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Fast 2000 kit, by Fastagen (1 mentions)
Bca protein assay kit, by Solarbio (1 mentions)
Elisa kits for tnf α, by R&D Systems (1 mentions)
Phosphate buffer, by Sinopharm (1 mentions)
Citrate buffer, by Sinopharm (1 mentions)
Absolute alcohol, by Sinopharm (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Mastercycler, by Eppendorf (1 mentions)
7 protocols using sybr green qpcr kit
1
Quantifying BDNF Expression in Rat Brain Tissue
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh culm tissues of the fourth internode (0.1 g) were ground to a fine powder in liquid nitrogen. Total RNA was extracted using RNAprep pure Plant Kit (Takara, Japan). The synthesis of the first strand cDNA was carried out with a PrimeScript™ RT reagent Kit (Takara, Japan) according to the manufacturer’s instructions. Gene expression was performed three times by quantitative reverse transcription-PCR (qRT-PCR) in a 20 μL reaction system: cDNA template 2.0 μL, 2 × SYBR Green1 Mix 10 μL, primer-F 0.5 μL, primer-R 0.5 μL, MilliQ 7.0 μL with SYBR Green qPCR kit (Cwbio, Beijing, China) on Two Color Real-time PCR Detection System (QuantStudio 3, Thermo Fisher Scientific, Waltham, Massachusetts, USA). Ubiquitin gene (AK059011) was used as an internal standard in the qRT-PCR. The gene expression unit was subjective to the percentage of the target gene expression value relative to the internal standard (Ubiquitin gene). The gene locus number and the primers used in this study were shown in Supplemental Table 2 .
3
Quantifying ked sex-specific gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from female and male keds with Trizol reagent (Invitrogen, USA). cDNA templates were synthesized from 1 μg RNA using the GoScript Reverse Transcription System (Promega, USA). Specific primers for mgp genes and Tubulin were designed with the identified gene sequences by genome analysis (Table S8 ). The relative expression levels were quantified using the SYBR Green qPCR kit (Cwbio, CHINA) and Applied Biosystems 7500 Fast Real-Time PCR system (Thermo, USA). Expression of target genes were normalized to the reference endogenous Tubulin and calculated by using the 2−ΔΔCt method. Statistical analysis was analyzed by Student’s t-test using GraphPad Prism 7 (GraphPad).
4
Quantifying Gene Expression in Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in the lung tissue and BALF of the rats were isolated by RNA extraction reagents (Biyuntian, P0013D). After that, cDNA was amplified from RNA with cDNA reverse-transcription kit (CWBIO, CW2569). The qRT-PCR was performed using SYBR Green qPCR kit (CWBIO, CW2601) and GAPDH was taken as a reference. 2−ΔΔCt method was utilized to calculate the related RNA expression. The list of qRT-PCR primers is given in Table 1 .
5
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and tissues using a Fast 2000 kit (Fastagen, China) following the manufacturer’s protocol. cDNA was synthesized using a Reverse Transcription Kit (CWBIO, China), followed by real-time PCR using a SYBR Green qPCR Kit (CWBIO, China) and CFX96 Real-time PCR detection system (Bio-Rad). The 2-ΔΔCt method was used to compute the fold difference. The primers used in this study are presented in Supplementary Table 6 .
6
Elucidating Inflammatory Pathways via ELISA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Paraxylene, absolute alcohol, citrate buffer, and phosphate buffer were purchased from SINOPHARM (Beijing, China). The enzyme-linked immunosorbent assay (ELISA) kits for TNF-α, IFN-γ, IL-1β, IL-4, and IL-10 were purchased from R&D Systems (Minneapolis, USA). The SYBR Green qPCR kit and reverse transcription kit were purchased from CWBIO (Beijing, China). The BCA protein assay kit and chemiluminescence detection reagent were purchased from Solarbio (Beijing, China). Anti-TLR4/MD2 complex (ab95562) and anti-NF-κB p65 (ab207297) were purchased from Abcam (Cambridge, USA). PSR decoction was prepared by the Ningbo City Hospital of Traditional Chinese Medicine. Biostime Probiotic Powder was purchased from BIOSTIME (Guangzhou, China).
7
Quantifying Neuroinflammatory Markers in Tissue and Serum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the brain tissues and serum was acquired using TriReagent (T9424, Sigma-Aldrich, USA). Next, cDNA was acquired using the reverse transcription kit (CW2569, CWBIO, China). QRT-PCR was utilized for examining the levels of IL-6, TNF-α, and IL-1β, which was carried out with the SYBR Green qPCR kit (CW2601, CWBIO, China) on a PCR instrument (Mastercycler, Eppendorf, Germany). GAPDH was served as the reference gene and data were expressed as 2−ΔΔCt method. The sequences of the primers are listed 5′ to 3′: TNF-α, (F) TATGGCTCAGGGTCCAACTC; (R) CTCCCTTTGCAGAACTCAGG; IL-1β, (F) GACCTTCCAGGATGAGGACA; (R) AGGCCACAGGTATTTTGTCG; IL-6, (F) CCGGAGAGGAGACTTCACAG; (R) TCCACGATTTCCCAGAGAAC; GAPDH, (F) ATGACATCAAGAAGGTGGTG; (R) CATACCAGGAAATGAGCTTG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!