Mirna extraction kit

Total RNA was extracted by a RNeasy^® Mini Kit (QIAGEN, Hilden, Germany). RNase R (Beyotime, Shanghai, China) was used to detect circRNA. Genomic DNA (gDNA) was isolated using a Genomic DNA Extraction Kit (Omega Bio-Tek, Norcross, GA, USA). Quantification of RNA and gDNA was performed using the TOROIVD^® qRT Master Mix and SYBR Green qPCR Master Mix (TOROIVD, Shanghai, China). miRNA was isolated using the miRNA Extraction Kit (Sangon Biotech, Shanghai, China), and a Bulge-Loop miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China) was used to perform real-time PCR. The circRNA and mRNA levels were normalised to those of β-actin, and miRNA was normalised to that of U6 and determined using the 2^−ΔΔCt method. The primer sequences used in this study are shown in Additional file 3: Table S2.

Total RNAs of the renal tissues were extracted with the miRNA extraction kit (Sangon Biotech Co., Ltd., Shanghai, China). Reverse transcription was performed using a miRNA first-strand cDNA (synthesis tail method) kit (Sangon Biotech Co., Ltd., Shanghai, China). Specific primers for U6, miR-192, and miR-200b were designed by Qiagen (Valencia, CA, USA), and the primer sequences (5′→3′) were AACGCTTCACGAATTTGCGT, CTGACCTATGAATTGACAGCC, and TAATACTGCCTGGTAATGATGA, respectively. qPCR was carried out in 20 μL final volumes with 2 μL cDNA, 3 μL RNase-free H₂O, 10 μL 2× miRNA qPCR Master Mix (Sangon, Shanghai, China), 2 μL universal PCR primer, 1 μL ROX Reference Dye (Sangon, Shanghai, China), and 2 μL specific primers. qPCR was performed with a real-time PCR thermocycler (Applied Biosystems, Foster City, CA, USA) under the following conditions: predenaturation at 95°C for 5 s and then 40 cycles of denaturation at 95°C for 30 s and annealing/extension at 60°C for 30 s. miR-192 and miR-200b relative expression levels were calculated using the 2^−ΔΔCt method and normalized to the expression of U6.