Amplicons were cloned using a pCR®2.1-TOPO® cloning kit (Invitrogen™) before being submitted for nucleic acid sequencing. Samples were sequenced with the Big Dye terminator cycle sequencing ready reaction (Applied Biosystems™) in an ABI-PRISM 3100 Genetic Analyzer (ABI™), according to the manufacturer’s protocol. Sequence analyses were performed with BLASTN and BLASTX software (http://www.ncbi.nlm.nih.gov/blast/ ). Nucleotide sequences were aligned and compared to human-, animal-, and sewage-associated virus sequences available in the GenBank database using ClustalX 2.0 (Larkin et al. 2007 (link)). The alignments were performed with the BioEdit Sequence Alignment Editor Program, version 7.0.9 (Hall 1999 ). The algorithm to generate the phylogenetic trees was selected using Modeltest 3.7 software (Posada and Crandall 2001 (link)). The phylogenetic tree of the deduced amino acid sequences of the partial rep gene sequence was constructed using the Neighbor-Joining method (Saitou and Nei 1987 (link)). Evolutionary analyses were conducted in MEGA5 (Tamura et al. 2013 (link)). The amplified circovirus DNA fragments were provisionally named fur seal circovirus (FSCV) and fur seal feces-associated circoviridae (FSfaCV), followed by the last two digits of the sample number.
Big dye terminator cycle sequencing ready reaction
Manufactured by Thermo Fisher Scientific
Sourced in Germany, United States, United Kingdom
The Big Dye Terminator Cycle Sequencing Ready Reaction is a lab equipment product. It is used for DNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Pcr2.1 topo cloning kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
M13 forward or reverse primers, by Thermo Fisher Scientific (1 mentions)
Abi prism 310 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Qiaquick kit, by Qiagen (1 mentions)
Illustra gfx pcr dna and gel band purification kit, by GE Healthcare (1 mentions)
6 protocols using big dye terminator cycle sequencing ready reaction
1
Amplicon Sequencing and Phylogenetic Analysis of Fur Seal Circoviruses
2
Targeted Sequencing of IDH1/2 and TP53
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor DNA was extracted from fresh-frozen tissue using the NucleoSpin® Tissue kit (Macherey-Nagel) according to the manufacturer’s instructions. Purified DNA was quantified using the Nanodrop ND-1000® (NanoDrop Technologies). The targeted genes, IDH1/2 and TP53, were analyzed using Sanger sequencing. The primers are listed in Supplementary Table 1 . Cycle parameters comprised 95° C × 10 min; 40 cycles of 94° C × 30 s, 60° C × 45 s, 72° C × 45 s; 72° C × 10 min. PCR products were purified using the PCR NucleoFast® plate (Macherey-Nagel). Purified PCR products were sequenced using the Big-Dye® Terminator Cycle Sequencing Ready Reaction (Applied Biosystems). Sequences were purified with Sephadex Superfine G50 (Sigma Aldrich) and analyzed on an ABI Prism 3710 DNA Analyzer (Applied Biosystems).
3
Nested-PCR for NCCR Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A nested-PCR was used to obtain the NCCR product for sequencing. Briefly, 100 ng of total DNA was amplified using two pairs of primers: first pair of primers, BKTT1 forward 5′ AAG GTC CAT GAG CTC CAT GGA TTC TTC C 3′ and BKTT2 reverse 5′ CTA GGT CCC CCA AAA GTG CTA GAG CAG C 3′, generating a 684 bp DNA fragment; the second pair of primers, BK-1 forward 5′ GGCCTCAGAAAAAGCTTCCACACCCTTACTACTTGA 3′ and BK-2 reverse 5′ CTTGTCGTGACAGCTGGCGCAGAA 3′, that amplified a portion of the first amplicon generating a fragment of 354 bp. The PCR products were purified using the PCR purification Kit (Qiagen, Hilden, Germany) and sequenced using the BigDye Terminator Cycle-Sequencing Ready Reaction (Applied Biosystems, Foster City, CA, USA). The sequences were analysed and edited using Bioedit 5.0.9 (Tom Hall of Ibis Therapeutics, Carlsbad, CA, USA).
4
Plasmid Isolation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The purified PCR products were ligated in pGEM-T Easy vector according to standard protocols (Promega, Madison, WI, USA). Procedures for transformation and plating of E. coli DH5 strain were described elsewhere [30 ]. Individual colonies (134) were randomly chosen to grow in liquid medium for plasmid DNA extraction using Concert Rapid Plasmid Miniprep System (Life Tech) to be subsequently analyzed by Southern-blot hybridization using salivary gland DNA of T. pubescens as a probe. Sequencing reactions of both strands of plasmid DNAs were performed with Big Dye Terminator Cycle Sequencing Ready Reaction as recommended by the manufacturer (Applied Biosystems, Foster City, CA, USA) using M13 Forward or Reverse primers (Life Tech) and subsequently run in the ABI PRISM 310 Genetic Analyzer (Applied Biosystems). GenBank searches were done with BLAST [31 (link)].
5
Hepatitis E Virus Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples with HEV-RNA were submitted to nested-PCR in order to amplify 287 base pairs of HEV ORF1 [37 (link)]. The PCR products were purified using the QIAquick kit (Qiagen) and sequenced in both directions using the Big Dye Terminator Cycle Sequencing Ready Reaction (Applied Biosystems) and 3130 Genetic Analyzer (Applied Biosystems). The nucleotide sequences were edited and aligned using AliView software [38 (link)]. HEV ORF1 sequences belonging to genotypes 1, 2, 3 and 4 were accessed on GenBank and added to the alignment (Supplementary Material—Table S1 ). A phylogenetic tree of maximum likelihood (ML) was reconstructed with PhyML 3.1 [39 (link)] and used to identify the HEV genotypes under the best nucleotide substituion model, which was selected by the Smart Model Selection software [40 (link)] integrated into the PhyML Web server (http://www.atgc-montpellier.fr/phyml ; accessed on 29 April 2021). The SPR branch-swapping algorithm was used for the heuristic tree search, and the phylogenetic tree was drawn with FigTree 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree ; accessed on 29 April 2021).
6
CRISPR Gene Sequence Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to confirm the CRISPRs amplifications, PCR products amplified of CRISPR1-cas, orphan CRISPR2 and CRISPR3-cas genes were submitted to nucleotide sequence analysis. The DNA fragments were purified using illustra GFX™ PCR DNA and gel band purification kit (GE Healthcare-Buckinghamshire, United Kingdom -UK).
Sequencing was carried out with the Big Dye Terminator Cycle Sequencing Ready Reaction (Applied Biosystems) in an ABI-PRISM 3100 Genetic Analyzer (ABI), according to the protocol of the manufacturer. The sequences obtained were compared with homologous nucleotide sequences deposited in GenBank).
Sequencing was carried out with the Big Dye Terminator Cycle Sequencing Ready Reaction (Applied Biosystems) in an ABI-PRISM 3100 Genetic Analyzer (ABI), according to the protocol of the manufacturer. The sequences obtained were compared with homologous nucleotide sequences deposited in GenBank).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!