RNA preparations were extracted as described above in triplicate with three biological replications using the RNAprep Pure Plant Plus Kit (Tiangen, Beijing, China). First-strand cDNA synthesis was performed using a FastQuant cDNA Synthesis kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. All gene-specific primers were designed using Primer 5.0 (PREMIER Biosoft International, Canada) (Table S6 ), and qRT-PCR was performed using a DyNAmo Flash SYBR Green qPCR kit (Thermo, USA) and a CFX96 qPCR System (Bio-Rad, USA). Expression levels were calculated using the 2−ΔΔCt method and were normalized to the level of the reference gene LEA2653 (link).
Fastquant cdna synthesis kit
Manufactured by Tiangen Biotech
Sourced in China
The FastQuant cDNA Synthesis kit is a laboratory product designed for the conversion of RNA into complementary DNA (cDNA) molecules. The kit provides the necessary reagents and protocols to efficiently perform this reverse transcription process, which is a fundamental step in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Rnaprep pure plant plus kit, by Tiangen Biotech (2 mentions)
Trizol regent, by Thermo Fisher Scientific (2 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Cfx96 qpcr system, by Bio-Rad (1 mentions)
Primer 5, by Premier Biosoft (1 mentions)
Dynamo flash sybr green qpcr kit, by Thermo Fisher Scientific (1 mentions)
Mircute mirna first strand cdna synthesis kit, by Tiangen Biotech (1 mentions)
Mircute mirna qpcr detection kit sybr, by Tiangen Biotech (1 mentions)
Trizol, by Tiangen Biotech (1 mentions)
Superreal premix plus sybr green, by Tiangen Biotech (1 mentions)
Mircute plus mirna first strand cdna synthesis kit, by Tiangen Biotech (1 mentions)
Superreal premix plus, by Tiangen Biotech (1 mentions)
Mircute mirna qpcr detection kit, by Tiangen Biotech (1 mentions)
Abi 7500 real time pcr detection system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Superreal premix plus kit, by Tiangen Biotech (1 mentions)
10 protocols using fastquant cdna synthesis kit
1
RNA Extraction and Gene Expression Analysis
2
Sepsis Peripheral Blood miRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral arterial blood from patients with sepsis was collected within 24 h after their diagnosis. All samples were anticoagulated with ethylenediaminetetraacetic acid. Whole blood was treated with erythrocyte lysis buffer. For each 200-μL sample of blood, 1 ml TRIZOL (Tiangen Biotech Company, Beijing, China) was added and stored at − 80 °C. Blood cells from fresh peripheral blood were sorted into monocytes, lymphocytes, and neutrophils using flow cytometry (FCM). Total RNA was extracted from 200 μL of the blood sample, which had been stored at − 80 °C, as described above. miRNA levels in the total RNA were detected by real-time quantitative PCR (qRT-PCR) using a miRcute miRNA first-strand cDNA synthesis kit and miRcute miRNA qPCR detection kit (SYBR) (Tiangen Biotech Company). RNA levels were detected using a FastQuant cDNA synthesis kit and a SuperReal qRT-PCR detection kit (Tiangen Biotech Company). All procedures followed the manufacturer’s instructions. qRT-PCR was performed in triplicate. To normalize the expression levels of miRNAs, we used 5S rRNA as an internal control. The threshold cycle (CT) is defined as the fractional cycle number at which the fluorescence passes the fixed threshold.
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol regent (Invitrogen) was used to extracted total RNA, and FastQuant cDNA Synthesis Kit (TIANGEN, Beijing, China) was used to performed reverse transcription from 2 μg total RNAs. Quantitative real-time PCR was carried out with SuperReal PreMix Plus (SYBR Green, TIANGEN, Beijing, China) according to the manufacture’s instruction on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). For all qRT-PCR experiments, data analysis was performed byΔΔCt method and GAPDH was used as controls.
4
Quantitative Analysis of mRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol regent (Invitrogen), and reverse transcription was performed from 2 μg total RNAs using a FastQuant cDNA Synthesis Kit or miRcute Plus miRNA First-Strand cDNA Synthesis Kit (TIANGEN, Beijing, China). Quantitative real-time PCR was carried out on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with SuperReal PreMix Plus or miRcute miRNA qPCR Detection Kit (SYBR Green, TIANGEN, Beijing, China) according to the manufacture’s instruction. The quantity of mRNA and miRNA was calculated using ΔΔCt method and GAPDH and U6 were used as controls. All reactions were performed as triplicates. The primer sequences are listed in Table S4 .
5
Adipose Tissue RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from adipose tissues by using TRIzol reagents (Thermo Fisher, Life Technologies, USA) and following the manufacturer’s instructions. Total RNA was quantified by NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific Inc., USA). Complementary DNA (cDNA) was synthesized by Fast Quant cDNA Synthesis Kit (TIANGEN, China). Quantitative PCR analysis were performed on ABI7500 Real-Time PCR Detection System (Thermo Fisher, USA) with SuperMix Real PreMix Plus (SYBR green) (TIANGEN, China). Sequences of primers were listed in Supplementary Table 1
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted with Trizol reagent from the 5th nymph wing discs, digested with DNase I, and reverse transcribed using the FastQuant cDNA Synthesis kit (Tiangen Biotech), then quantitative real-time RT-PCR was performed using Go Taq qPCR Master Mix (Promega). The primers for quantitative RT-PCR were as follows:
Lmsal411q-F 5′-GAGAATGCCAGCCAGGGTC-3′
Lmsal411q-R 5′-CGGTGCTTGAAGAAGGGTT-3′
Lmsal468q-F 5′-ACCAAAACATCGGAGACA-3′
Lmsal468q-R 5′-ATAGGACACGGTGGCAGA-3′
Relative transcript levels were assessed using the Comparative CT method. β-actin was used as an internal control.
Lmsal411q-F 5′-GAGAATGCCAGCCAGGGTC-3′
Lmsal411q-R 5′-CGGTGCTTGAAGAAGGGTT-3′
Lmsal468q-F 5′-ACCAAAACATCGGAGACA-3′
Lmsal468q-R 5′-ATAGGACACGGTGGCAGA-3′
Relative transcript levels were assessed using the Comparative CT method. β-actin was used as an internal control.
7
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were sacrificed and their brain cortex and striatum were isolated and homogenized using the TRI Reagent (Sigma-Aldrich). For HBMECs, the total RNA was extracted from the cells with the TRI Reagent. The first-strand cDNA was generated from 2 μg of the isolated total RNA using the FastQuant cDNA synthesis kit (Tiangen, Beijing, China), according to the manufacturer's instructions. Appropriate primers were designed and are listed in Supplementary Table 1 . All reactions were performed on an ABI 7500 real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) with the SuperReal Premix Plus kit (Tiangen), according to the manufacturer's instructions. Finally, real-time PCR products were analyzed with agarose gel electrophoresis, while their relative expression levels were estimated using the ΔΔCT method, with β-actin representing the internal control to normalize gene expression.
8
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from individuals or tissues using a Total RNA Extraction Kit (Omega BIO-TEK, Norcross, GA, USA), according to the manufacturer’s instructions. The concentration of RNA was determined using a Nanodrop spectrophotometer (Shimadzu, Kyoto, Japan), and RNA purity was detected using agarose gel electrophoresis. The cDNA template was synthesized using the FastQuant cDNA Synthesis Kit (TIANGEN, Beijing, China).
9
Quantifying mRNA and miRNA Expression in Aortic VSMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At 48 h after transfection, human aortic VSMCs were treated with TRIzol® reagent (Tiangen Biotech Co., Ltd.) to isolate the total RNA. For amplification of ACSS2, total RNA was reverse transcribed to cDNA using the FastQuant cDNA synthesis kit (Tiangen Biotech Co., Ltd.), and then qPCR was performed using SuperReal PreMix (Tiangen Biotech Co., Ltd.). For amplification of miR-15b-5p, first strand cDNA synthesis was conducted with the miRNA 1st-Strand cDNA Synthesis kit (by stem-loop; Vazyme Biotech Co., Ltd.), and qPCR was run according to the instructions of the miRNA Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd.). Primers were synthesized by the Beijing Dingguo Changsheng Biotechnology Co., Ltd., and were as follows: ACSS2, CGTGATGGGGCTTCCTGAG (forward) and GTTGTACCGAAGGAATGGGC (reverse); miR-15b-5p, CGCGTAGCAGCACATCATGG (forward) and GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGTAAA (reverse); β-actin, ACACTGTGCCCATCTACG (forward) and TGTCACGCACGATTTCC (reverse); and U6, CTCGCTTCGGCAGCACA (forward) and AACGCTTCACGAATTTGCGT (reverse). β-actin and U6 served as an endogenous reference for mRNAs and miRNAs, respectively. The PCR procedure was: Denaturation at 95˚C for 15 min, followed by 40 cycles of 95˚C for 10 sec, 60˚C for 20 sec and 72˚C for 30 sec. The relative expression levels of mRNAs and miRNAs were determined using the 2-ΔΔCq method (17 (link)).
10
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNAprep Pure Plant Plus Kit (Tiangen, Beijing, China) was used for total RNA extraction. Genomic DNA was eliminated from the total RNA using RNase-free DNase I. The RNA integrity was confirmed by 1.0% agarose gel electrophoresis. RNA concentrations were determined by NanoDrop™ 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA), samples with an A260/A280 ratio of 1.8–2.2 and an A260/A230 ratio >2.0 were used for further analyses. First-strand cDNA synthesis was performed using a FastQuant cDNA Synthesis kit (Tiangen, Beijing, China) according to the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!