Total RNA was extracted from the proximal femur using RNAiso Plus (Total RNA Extraction Reagent, TaKaRa Bio Inc, Tokyo, Japan) in accordance with the manufacturer’s protocol. Total RNA of each group was extracted at optimal effect of induction. Approximately 1000ng of total RNA was reverse transcribed using the Prime Script1TM RT Reagent Kit with gDNA Erase (TaKaRa Bio Inc, Tokyo, Japan). qPCR was performed in triplicate in a 20μl volume, using SYBR1Premix Ex TaqTM II (TaKaRa Bio Inc, Tokyo, Japan) and the CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad, CA, USA) according to the manufacturers’ instructions. Gene expression was determined relative to the housekeeping gene GAPDH using the 2–ΔΔCt method [39 (link)]. Specific primers were list as follows within the Sangon Biotech (Shanghai, China) designed (Table 1 ).
Sybr1 premix ex taqtm 2
Manufactured by Takara Bio
Sourced in Japan, United States
SYBR1 Premix Ex TaqTM II is a ready-to-use reagent for real-time PCR amplification. It contains SYBR Green I dye, Taq DNA polymerase, and optimized buffer components.
Automatically generated - may contain errors
Lab products found in correlation
Abi 7500 sequencing detection system, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Rnaiso plus total rna extraction reagent, by Takara Bio (1 mentions)
Prime script1 rt reagent kit with gdna erase, by Takara Bio (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Reverse transcriptase, by Takara Bio (1 mentions)
Alpha modification of eagle s medium α mem, by Thermo Fisher Scientific (1 mentions)
Phospho sapk jnk, by Cell Signaling Technology (1 mentions)
Sapk jnk, by Cell Signaling Technology (1 mentions)
P iκbα, by Cell Signaling Technology (1 mentions)
C fos, by Cell Signaling Technology (1 mentions)
Phospho p38, by Cell Signaling Technology (1 mentions)
Phospho nf κb pp 65, by Cell Signaling Technology (1 mentions)
20 s protopanaxadiol, by Merck Group (1 mentions)
Histone h3, by Cell Signaling Technology (1 mentions)
Phospho erk1 2, by Cell Signaling Technology (1 mentions)
Recombinant murine m csf, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Cell counting kit 8 cck 8, by Dojindo Laboratories (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
7 protocols using sybr1 premix ex taqtm 2
1
Quantifying Gene Expression in Femur Tissue
2
Osteoclastogenesis Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was used to measure the expression of Slc4a2, Nfatc1, Trap, cathepsin K (Ctsk), calcitonin receptor (Ctr), and Gapdh mRNAs. BMM cells were seeded in 6-well plates at a density of 1 × 105 cells/well and cultured in complete α-MEM. During RANKL-induced osteoclastogenesis, the BMMs were treated with or without 100 ng/mL RANKL, with or without 0.1 mg/mL Ti/PMMA particles, with or without shRNAs pre-treatments, and with or without 11R-VIVIT (2/5/10 μM). After the culture was sustained for 0–5 days, RT-PCR was used to assess the expression of these genes’ mRNAs in BMMs. The method of RT-qPCR in detail was described in a previous study (Wu et al., 2015 (link)). Total RNA was extracted using the Qiagen RNeasy Mini kit (Qiagen, Valencia, CA, United States) in accordance with the manufacturer’s instructions, and cDNA was synthesized from 1 mg of total RNA using reverse transcriptase (TaKaRa). Real-time PCR was performed using SYBR1 Premix Ex TaqTM II (TaKaRa) and an ABI 7500 Sequencing Detection System (Applied Biosystems, Foster City, CA, United States). The following cycling conditions were used: 40 cycles of denaturation at 95°C for 5 s and amplification at 60°C for 24 s. GAPDH was amplified as a housekeeping gene, and all reactions were run in triplicate. The sequences of the RT-qPCR primers were as follow:
3
Evaluating Osteogenic Potential of Bioceramic Solutions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We seeded and cultured 4 × 106 MC3T3-E1 cells/well in 24-well plates using the extracted CPS and Fe-CPS bioceramic solutions. After culturing the plates for 5 days, total RNA was collected employing the RNeasy Mini kit (Qiagen, Valencia, CA, USA), which was then synthesized into cDNA through reverse transcriptase (TaKaRa). We employed SYBR1 Premix ExTaqTM II (TaKaRa) and an ABI 7500 Sequencing Detection System (Applied Biosystems, Foster City, CA, USA) in real-time polymerase chain reaction (RT-PCR). The PCR primers were designed as given below:
Runx2 forward 5′-GACTGTGGTTACCGTCATGGC-3'.
and reverse 5′-ACTTGGTTTTTCATAACAGCGGA-3'.
ALP forward 5′-AGAAGTTCGCTATCTGCCTTGCCT-3'.
and reverse 5′-TGGCCAAAGGGCAATAACTAGGGA -3'.
OPN forward 5′-ACCCAGATCCTATAGCCACATG-3'.
and reverse 5′-TGGAATTGCTTGGAAGAGTTTC-3'.
Runx2 forward 5′-GACTGTGGTTACCGTCATGGC-3'.
and reverse 5′-ACTTGGTTTTTCATAACAGCGGA-3'.
ALP forward 5′-AGAAGTTCGCTATCTGCCTTGCCT-3'.
and reverse 5′-TGGCCAAAGGGCAATAACTAGGGA -3'.
OPN forward 5′-ACCCAGATCCTATAGCCACATG-3'.
and reverse 5′-TGGAATTGCTTGGAAGAGTTTC-3'.
4
Osteoclastogenesis Regulation by 20(S)-Protopanaxadiol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
20(S)-protopanaxadiol was taken from Sigma (≥ 97% purity, P0031, St. Louis, United States), dissolved in dimethyl sulfoxide (DMSO) and stored at −20°C. RAW264.7 cells were obtained from the Shanghai Cell Bank of the Chinese Academy of Science (Shanghai, China). Fetal bovine serum (FBS) and alpha modification of Eagles medium (α-MEM) were purchased from Gibco-BRL (Sydney, Australia). Recombinant murine M-CSF and RANKL were purchased from PeproTech (NJ, United States). Specific primary antibodies against NF-κB inhibitor alpha (IκBα) (#4814), p-IκBα (#9246), NF-κB p65 (#8242), phospho-NF-κB p-p65 (#3033), ERK1/2 (#4695), phospho-ERK1/2 (#4370), SAPK/JNK (#9252), phospho-SAPK/JNK (#4668), p38 (#8690), phospho-p38 (#4511), histone H3 (#4499), β-actin(#4967) and c-Fos (#4384) were purchased from Cell Signaling Technology (MA, United States). Antibodies against transforming growth factor activated kinase-1 (TAK1) (ab109526), phospho-TAK1(ab109404), NFATc1 (ab175134), were purchased from Abcam (Cambridge, United Kingdom). The Cell Counting Kit-8 (CCK8) was obtained from Dojindo Molecular Technology (Japan). The Prime Script RT reagent kit and SYBR1 Premix Ex TaqTM II were obtained from TaKaRa Biotechnology (Otsu, Shiga, Japan). Ti particles (99.99% purity, diameter ranging from 1 to 3 μm) were obtained from the Johnson Matthey Company (MA, United States).
5
Gene Expression Analysis of Ovarian Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovaries of the WT and tsp1a−/− XX fish were dissected at 5, 30, 60, 90 and 180 dah for gene expression assay. Total RNA (1.0 μg) was extracted and reverse transcribed using PrimeScript RT Master Mix Perfect Real Time Kit according to the manufacturer’s instructions (Takara, Dalian, China). qRT-PCR was performed on an ABI7500 qRT-PCR machine (Thermo Fisher, Waltham, MA, USA), according to the protocol of SYBR1 Premix Ex TaqTM II (Takara, Dalian, China). The relative abundance of key genes in the ovaries was evaluated using the formula R = 2−ΔΔCt. The reference gene tilapia eef1a1a was used to normalize the expression values.
6
Quantifying SDF1 and CXCR4 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR analysis of SDF1 and CXCR4 mRNA expression, total RNA from FA7DOWN/PA7UP, FSHUS/PNCEV and original F/P cells as well as normal liver cells in vitro and in vivo were extracted using Trizol reagent (Invitrogen, USA). Reverse transcription of purified RNA was performed using the PrimeScript1 RT reagent kit (Takara, Japan). Quantification of gene transcripts was performed by qRT-PCR (Fluorescence real-time quantitative PCR meter MX3005P, USA) using SYBR1 Premix Ex TaqTM II (Takara, Japan), and the levels were normalized to GAPDH as the internal control. Primer sequences (Takara, Japan) for SDF1, CXCR4 and GAPDH are listed in Table 2 . MXP software was used to analyze the results. Differences in mRNA expression were calculated according to the△△Ct method and displayed as 2(—△△Ct).
Primer sequences for SDF1, CXCR4 and GAPDH
| Sequence | Forward primer (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|
| Gene name | ||
| SDF1 | CCTGTGTGTCATGCCCTCTT | AGTCCAGCCTGCTATCCTCA |
| CXCR4 | GTCAACCTCTAGAGCAGCGT | CTATCGGGGTAAAGGCGGTC |
| GAPDH | AAATGGTGAAGGTCGGTGTGAAC | CAACAATCTCCACTTTGCCACTG |
7
Cardiac Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the cardiac tissues using the RNAiso plus kit (TAKARA). The transcript levels of brain natriuretic peptide (BNP) and β-myosin heavy chain (β-MHC) were analyzed by RT-PCR using the TOYOBO kit and the iQ5 Real-Time PCR Detection System (Bio-Rad, Hercules, CA) as per instructions. The SYBR1 premix Ex TaqTM II was used according to the recommended guidelines (TaKaRa Biotechnology Co. Ltd., Tokyo, Japan), and GAPDH was the internal standard. The melting curves and values were assessed with the Bio-RAD software. The relative mRNA level was quantified using the comparative cycle threshold method. Each sample was analyzed at least thrice.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!