Mrr hsdrms mcrbc

Escherichia coli Strain NEB10β (araD139 Δ(ara-leu) 7697 fhuA lacX74 galK (ϕ80 (M15) mcrA galU recA1 endA1 nupG rpsL (Str^R) Δ(mrr-hsdRMS-mcrBC)) (New England Biolabs, Table S2) was used for generation of all relevant strains for this study. E. coli cells were cultivated with LB medium supplemented with appropriate antibiotics when necessary at 37 °C with shaking. For microfluidic feedback testing, E. coli strains were grown in LB medium with antibiotics.

The strains, plasmids, and primers used in this work are listed in Table 1. Plasmid pOxyRS-sfGFP-AAV is derived from pOxyRS-sfGFP^{38 (link)} and incorporates a ssrA degradation tag encoding AANDENYLAAAV^{45 (link)} (“AAV”) at the 3ʹ end of sfGFP.Table 1

Strains, plasmids, and primers used in this study.

	Description	Source
Strains
E. coli
NEB10-beta	Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 galK16 galE15 e14-ϕ80dlacZΔM15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 Δ(mrr-hsdRMS-mcrBC)	New England Biolabs
W3110	K12 strain, wild type, λ-, F-, IN(rrnD-rrnE)1, rph-1s	Genetic Stock Center Yale University, New Haven, CT
ZK126	W3110 ΔlacU169 tna-2	58 (link)
SW102	ZK126 ΔoxyRS	59 (link)
Plasmids
pOxyRS-sfGFP	pBR322, oxyR under constitutive proD promoter, sfGFP under oxyS promoter. AmpR	38 (link)
pOxyRS-sfGFP-AAV	pOxyRS-sfGFP derivative with ssrA degradation tag encoding AANDENYLAAAV (“AAV”) at 3ʹ end of sfGFP before stop codon. AmpR	This work

Primers	Sequence and purpose	Source
oxyR_F	gccagccgacgcttagc (for oxyR qPCR)	60 (link)
oxyR_R	aacatcacgcccagctcatc (for oxyR qPCR)	60 (link)
16S_rRNA_F	gttaatacctttgctcattga (for E. coli 16s rRNA qPCR)	61 (link)
16S_rRNA_R	accagggtatctaatcctgtt (for E. coli 16s rRNA qPCR)	61 (link)
katG_F	gccgatctacaacccgac (for katG qPCR)	This work
katG_R	gtagaagcagatgcccagg (for katG qPCR)	This work

E. coli strain NEB10β (araD139 Δ(ara-leu) 7697 fhuA lacX74 galK (ϕ80 Δ(lacZ) M15) mcrA galU recA1 endA1 nupG rpsL (Str^R) Δ(mrr-hsdRMS-mcrBC)) (New England Biolabs) was used for fluorescent reporting of comparator circuit (Fig. 4). E. coli cells transformed with biological comparator with RFP reporter were shaken at 250 rpm overnight, 37 °C, in LB medium with 50 μg/mL kanamycin and 50 μg/mL carbenicillin. The next day, overnight culture was inoculated 1:100 ratio in 3 mL fresh LB medium with 50 μg/mL kanamycin and 50 μg/mL carbenicillin, and shaken at 250 rpm, 37 °C, for 25 minutes. 100 μg/mL AHL, and three different IPTG concentrations (1 mM, 500 μM, and 100 μM) were added to the inoculations. The culture with appropriate AHL and IPTG concentrations were then aliquoted to 96 well plates, and 0.8% Arabinose was 1:3 serial diluted to make the final circuit growth condition. After addition with the chemical inducers, inoculations were shaken at 700 rpm, 37 °C, for 4 hours in VWR 1585 Microplate shaker. The RFP molecular concentration was then measured by Molecular SpectraMax Paradigm Multi-Mode Microplate Reader.