Total RNA was isolated from cells using Trizol (Invitrogen, Carlsbad, CA, USA) and then reverse‐transcribed into cDNA using Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). The cDNA was amplified by quantitative real‐time PCR (qPCR) using primers specific for murine BMP3 (forward, tctcccaagtcatttgatgct; reverse, gcgtgatttgatggtttcaa), murine osteocalcin (OC) (forward, agactccggcgctacctt; reverse, ctcgtcacaagcagggttaag), murine SOST (forward, caggagaggaagcttgagtcc; reverse, agggtagaaagacccccatc), murine DKK1 (forward, ccgggaactactgcaaaaat; reverse, ccaaggttttcaatgatgctt), murine alkaline phosphatase (ALP) (forward, cggatcctgaccaaaaacc; reverse, tcatgatgtccgtggtcaat), and β‐actin (forward, aaggccaaccgtgaaaagat; reverse, gtggtacgaccagaggcatac). qPCR was performed in 96‐well plate using Fast Start Universal SYBR Green Master (Roche) with iCycler Multicolor Real‐Time PCR Detection system (BIO‐RAD, Richmond, CA, USA) 27 . Values were normalized to β‐actin using the 2‐ΔΔCt method 28 .
Icycler multicolor real time pcr detection system
Manufactured by Bio-Rad
Sourced in United States, China
The ICycler Multicolor Real‐Time PCR Detection system is a laboratory instrument designed for real-time PCR analysis. It is capable of detecting and quantifying multiple fluorescent signals simultaneously during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
Faststart universal sybr green master, by Roche (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Superreal premix plus sybr green, by Tiangen Biotech (1 mentions)
2 protocols using icycler multicolor real time pcr detection system
1
Quantitative Real-Time PCR of Murine Genes
2
Notch Signaling and Osteogenesis in Ligamentum Flavum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of Notch signaling pathway genes and osteogenic markers genes in ligamentum flavum cells were assessed by real-time RT-PCR at the indicated time points. Total RNA was isolated from cells using Trizol (Invitrogen, Carlsbad, CA) and reverse transcribed into cDNA using a RevertAid First Strand cDNA Synthesis Kit (K1622; Thermo). SYBR green-based quantitative real-time PCR (qPCR) was performed in 96-well plates using Super-Real PreMix Plus SYBR Green (FP205; TIANGEN, Beijing, China), and an iCycler Multicolor Real-Time PCR Detection system (BIO-RAD, Hercules, VA). Values were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the 2 ÀDCt method or corresponding groups using the 2 ÀDDCt method. Table 2 describes the detailed primer sequences.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!