Anti β3 tubulin

Western Blotting was used to measure the relative protein level of RSC 96 that cultured with electrospun membranes for 4 days. The total proteins were collected and transferred onto PVDF membranes. And the samples were incubated at 4 ​°C overnight with several primary antibodies, anti-S100β (1:2000, Abcam, USA), anti-MBP (1:5000, Abcam, USA), anti-β3-Tubulin (1:1000, Abcam, USA), anti-GAP43 (1:1000, Abcam, USA), anti-Ki67 (1:5000, Abcam, USA), and GFAP (1:8000, Abcam, USA). Real-time PCR (qPCR) was used to measure the relative mRNA level of RSC 96 that cultured with electrospun membranes for 4 days. The total RNA was collected by TRIzol. (Thermo Fisher Scientific, USA). RNA was then reverse-transcribed into cDNA and run on a real-time PCR biosystem (Applied Biosystems, USA). The primer sequences were S100β (Forward (5′–3′) ATGGTTGCCCTCATTGATGTCTTCC, Reverse (5′–3′) ACCACTTCCTGCTCTTTGATTTCCTC), MBP (Forward (5′–3′) TCTGGAAAGCGAGAATTAGCATCTGAG, Reverse (5′–3′) ACTGTCTTCTGAGGCGGTCTGAG), Ki67 (Forward (5′–3′) GCCAAGAAGACGACTCAAGAGACTG, Reverse (5′–3′) TGTGCCGAAGACTCCTTAAACTCATC), β3-Tubulin (Forward (5′–3′) TGGAGAACACGGATGAGACCTACTG, Reverse (5′–3′) GGTAGCAGACACAAGGTGGTTGAG), GAP43 (Forward (5′–3′) TCTGAGGAGAAGAAGGGCGAAGG, Reverse (5′–3′) AGGACGGCGAGTTATCAGTGGTAG), and GAPDH (Forward (5′–3′) TCGTGGAGTCTACTGGCGTCTT, Reverse (5′–3′) AGGGAGTTGTCATATTTCTCGTGGTTC).

The paraffin-embedded sciatic nerve sections were incubated at 4 °C overnight with the following primary antibodies: anti-S100β (1:100, Abcam, USA), anti-CD-3 (1:150, Abcam, USA), anti-Ki67 (1:500, Abcam, USA), anti-C-caspase-3 (1:100, Abcam, USA), anti-MBP (1:1000, Abcam, USA), anti-β3-Tubulin (1:2000, Abcam, USA), anti-GAP43 (1:100, Abcam, USA), and DAPI (1:1000, Abcam, USA) was used to stain the nuclei. The results were measured by Fluorescence Microscope and Optical Microscope (Olympus CX33, Japan).