Glomax20 20 illuminometer

The target genes and the binding sites of miR-19-3p were predicated with TargetScan software (TargetScanHuman 7.1). According to the results of the target genes predicted by bioinformatics software, luciferase activity assay was performed for further confirmation according to the protocols.^{18 (link)} In brief, the wild-type (WT, UCUACCUCAAAGACCUUUGCACA) and mutant miR-19-3p binding regions in the 3′-UTR of fas gene (UCUACCUCAAAGACCCAAUUCGC) were cloned into pMIR-REPORT luciferase reporter plasmids (Promega Corporation, Madison, Wisconsin). Micro RNA-19-3p mimic, inhibitor, and negative control were co-transfected into HCT116 cells with luciferase reporter plasmids. The cells were cultivated at 37°C, 5% CO₂ condition for 24 hours, followed by the fluorescence intensity measurement using GloMax20/20 illuminometer (Promega Corporation). All experiments were performed in triplicate.