F2hfd1

The animals used in this study were treated in accordance with the Guidelines for Animal Experiments published by the Japanese Association for Laboratory Animal Science, ARRIVE guidelines and the Animal Research Center of the Okayama University of Science, Japan. All experiments were approved by the Animal Care and Use Committee of the Okayama University of Science. Efforts were made to minimize the number of animals used and animal suffering. Mice were housed in a specific pathogen-free room under controlled humidity (50%) and temperature (22 °C) conditions with 12-h light–dark cycles. Male, 4-week-old C57BL/6 J mice were purchased from Shimizu Experimental Animals (Kyoto, Japan) and habituated to a colony for 1 week. ApoE^−/− mice (B6.129P2-Apoe tmlUnc, backcrossing at least 10 generations to C57BL/6 J inbred mice; The Jackson Laboratory, Bar Harbor, ME, USA) and C57BL/6 J mice were fed a high-fat diet (HFD; F2HFD1, Oriental Yeast Co., Ltd., Tokyo, Japan) containing 1.25% cholesterol, cocoa butter fat, and 3.0% lard, for either 5 or 10 weeks. In total, 183 mice were used in these experiments (29 C57BL/6 J mice and 154 ApoE^−/− mice).

All mouse experiments were approved by the Institutional Animal Care and Use Committees of Hiroshima University. All animal procedures were performed under the guidelines established by the Animal Experimentation Committees of Hiroshima University. All the animal experiments in this study complied with the ARRIVE guidelines. ApoE^−/− mice on C57BL/6 J background (Stock #002052) were purchased from The Jackson Laboratory (ME, USA). Ku80^−/− 129/Svj mice were generously provided by Dr. Noboru Motoyama with permission from Dr. André Nussenzweig^{26 (link)}. The Ku80^−/− 129/Svj mice were backcrossed into a C57BL/6 J background and then cross-bred with the ApoE^−/− mice to generate Ku80^+/−ApoE^−/− mice. Their genotypes were identified by polymerase chain reaction (PCR). The primers used for genotyping were as follows: Ku80 KO, forward, 5′ AGCTTCCACCCTCTAGAGAT 3′; Ku80 wild-type, forward, 5′ TAAAGCGCATGCTCCAGACT 3′; and Ku80 complement, reverse, 5′ ATTGTGATGTGTGGGACACG 3′. The male mice were fed with a high-fat diet (F2HFD1: fat, 36% of total kcal; cholesterol, 1.25%; Oriental Yeast Co., Tokyo, Japan) starting from 60 days of age for either 2 or 4 weeks. All mice were housed under a 12-h light and dark cycle. The mice were asphyxiated by gaseous carbon dioxide, and the aorta was isolated from them.

Animal experiments were performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of Tokyo University of Pharmacy and Life Sciences (no. L19-16). A total of 21 male spontaneously hyperlipidemic Apoe^−/− mice (KOR/StmSlc-Apoe^shl mice) were purchased from Japan SLC (Hamamatsu, Japan). Mice were fed a high cholesterol diet containing 1.25% cholesterol, 3.0% lard, and 1.625% glucose (F2HFD1, Oriental Yeast, Tokyo, Japan), starting at 13 weeks of age [2 (link), 29 (link)–37 (link), 39 (link), 40 (link)]. At 13 weeks of age, five mice were sacrificed as preinfusion controls. The remaining 16 were divided into two groups of eight each and were infused with saline (vehicle) or β-endorphin (5 μg/kg/h) using osmotic minipumps (Alzet Model 1002; Durect, Cupertino, CA, USA) for 4 weeks. Doses of β-endorphin were selected based on others' previous data and our preliminary data [32 (link)–35 (link)]. Once every 2 weeks, the minipumps were implanted subcutaneously into the dorsum under medetomidine-midazolam-butorphanol anesthesia (0.3 mg/kg, 4.0 mg/kg, and 5.0 mg/kg, respectively, intraperitoneal injection).