Blasticidin

B16 cells (RCB1283) (MTA; RM87746), HMV-II cells (RCB0777) (MTA; RM87747), or COLO679 cells (RCB0989) (MTA; RM87746) were purchased from RIKEN BRC (RIKEN, Ibaragi, Japan). B16 cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 2 mM L-Glutamine [36 (link)]. HMV-II cells were maintained in DMEM/Ham’s F-12 supplemented with10% FBS. COLO679 were maintained in RPMI Medium1640 supplemented with 20% FBS. B16 cells were transfected with Myc-tagged murine Tle3 (1-782), Myc-taged murine Tle3 (1- 140) [12 (link)], Myc-pcDEF3 empty vector (Control), shRNA against murine Tle3 (#1792), or shRNA against LacZ (Control) [29 (link)]. Cells transfected with Myc-pcDEF3 or Myc-pcDEF3 empty vector were treated with G418 (Roche, Basel, Switzerland) for 2 weeks until G418-resistant clones emerged. Cells transfected with shRNA against murine Tle3 (#1792) or LacZ (control), were treated with blasticidin (Wako, Osaka, Japan) to obtain blasticidin resistant clones.

HLF cells were plated at a density of 1.5 × 10⁵ cells per 6-well plate one day before infection. The next day, the medium was replaced with serum-free medium containing 4 µg/mL polybrene (Merck Millipore, Burlington, MA, USA) and transduced with lentivirus containing lentiCas9-Blast at a multiplicity of infection (MOI) of 10. The following day, cells were supplemented with complete medium containing 4.0 μg/mL blasticidin (Fujifilm Wako pure chemical corporation, Osaka, Japan) for 7 days. Then, several single clones were established by the limiting dilution method, and Cas9 expression in these cells was confirmed by WB analysis and flow cytometry.
To generate LATS2-depleted cells by CRISPR, Cas9-positive HLF cells were plated at a density of 1.5 × 105 cells per 6-well plate one day before infection. The next day, the medium was changed into serum-free medium containing 8 µg/mL of polybrene and transduced with lentivirus containing lentiguide-puro vector cloned with gRNA targeting LATS2 (gRNA-1: ACCAGCAGAAGGTTAACCGG, gRNA-2: ATAAGGTCCGAACTTTGGGG) at an MOI of 2–3. The following day, cells were supplemented with complete medium containing 1.0 μg/mL puromycin (Thermo Fisher Scientific) for 7 days.

The wild-type K. phaffii strain CBS7435 (NRRL-Y11430) was used in the REMI screen. The K. phaffii strain dnl4his4^{33 (link)} was used for accurate gene disruptions in the effective factor validation and multiple-disruption processes. E. coli strain DH5α was used for recombinant DNA manipulation.
K. phaffii strains were grown in YPD or YPG media [10 g/L yeast extract (Nacalai Tesque, Kyoto, Japan), 20 g/L Bacto peptone (BD Biosciences, San Jose, CA, USA) and 20 g/L glucose (for YPD) or 20 g/L glycerol (for YPG)], or in BMGY or BMMY media [10 g/L yeast extract, 20 g/L hipolypeptone (Nihon Pharmaceutical, Tokyo, Japan), 13.4 g/L yeast nitrogen base without amino acids (BD Biosciences), 0.4 mg/L biotin (Nacalai Tesque), 100 mM potassium phosphate buffer (final, pH 6.0) and 20 g/L glycerol (for BMGY) or 20 g/L methanol (for BMMY)]. E. coli strains were grown in LB media with 5 g/L yeast extract, 10 g/L tryptone (Nacalai Tesque) and 5 g/L NaCl, supplemented with ampicillin (100 μg/mL). YPD agar plate contained 20 g/L agar in YPD media with antibiotics (500 μg/mL G418 (Wako Pure Chemical Industries, Osaka, Japan), 100 μg/mL Zeocin (InvivoGen, San Diego, CA, USA), 100 μg/mL hygromycin (Wako Pure Chemical Industries), 50 μg/mL nourseothricin (Werner BioAgents, Jena, Germany), and/or 100 μg/mL blasticidin (Wako Pure Chemical Industries)). Square YPD plates contained 100 μg/mL Zeocin.