Raw264

The mouse monocyte/macrophage cell line RAW264.7 was purchased from the American Type Culture Collection (ATCC) and maintained in Dulbecco's modified eagle's medium (HyClone) supplemented with 10% FBS. Differently treated hPDLSCs were co‐cultured with RAW264.7 cells, and TRAP staining was performed as previously reported.22 Briefly, hPDLSCs were seeded into 24‐well plates (Corning; 1 × 10⁵ cells/mL/well). After 12 hours, RAW264.7 cells (1 × 10⁶ cells/mL/well) were directly added into the α‐MEM culture medium containing 30 ng/mL human macrophage colony stimulatory factor (Wobai). After 14 days, the cells were subjected to TRAP staining using an acid phosphatase leucocyte kit (Sigma‐Aldrich). Ten different visual fields in each group were randomly selected to calculate the number of TRAP‐positive cells.

The mouse macrophage cell line RAW264.7 cells (CL-0190) were obtained from Procell Life Science Technology Co, Ltd. (Wuhan, China). Mature 3 T3-L1 adipocytes and RAW264.7 macrophages were co-cultured in a Transwell system (Corning, USA) with a 0.4 μm porous membrane. After the 3 T3-L1 preadipocytes fully differentiated into mature adipocytes in a 6-well plate in the lower chamber, 5 × 10⁴ RAW264.7 macrophages were planted into the upper chamber. After 24 h, the upper chamber RAW264.7 macrophages were pretreated with 4-HIL (20 μM, ≥98.0%, 50,118-50MG, Sigma, USA) [26 (link)] 4 h before LPS (100 ng/mL, L2630-10MG, Sigma, USA) stimulation. After 6 h of LPS intervention, the total protein and nuclear protein, as well as mRNA, were then extracted from the RAW264.7 macrophages and 3 T3-L1 adipocytes. The culture supernatant was collected and stored at − 80 °C for ELISA.

RAW 264.7 macrophages (American Type Culture Collection, ATCC, Manassas, VA, USA) were seeded in 6-well culture plates (Corning Inc., Corning, NY, USA), at a density of 1.5 × 10⁵ cells/mL, in 3 mL of Dulbecco’s modified eagle medium (DMEM, Sigma-Aldrich Corporation, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, BRL), 1 mM L-glutamine (BioWhittaker Europe, Verviers, Belgium), penicillin (200 µg/mL, BioWhittaker Europe, Verviers, Belgium), and streptomycin (200 µg/mL, BioWhittaker Europe) at 37 °C under a CO₂ (5%) atmosphere. To analyze the effects of the ions released by MBG-75S, concerning the possible regulatory role of macrophages on in vitro osteogenesis, RAW 264.7 cells were cultured in the absence (control macrophages) or in the presence of 1 mg/mL of MBG-75S deposited on 6-well transwell inserts (0.4 µm pore size, Corning Inc., Corning, NY, USA), which is covered by the culture medium. After 24 h of culture, the media from these macrophage cultures were collected and diluted 1:1 with α-MEM for subsequent treatment of MC3T3-E1 pre-osteoblasts (10⁴ cells/mL) for 10 days, as it is indicated in Scheme 1. ALP activity of MC3T3 -E1 cells was then assessed as specific marker of in vitro osteogenesis, as described in Section 2.7.

The mouse macrophage cell line RAW264.7 was obtained from American Type Culture Collection (ATCC, VA, USA). The mouse microglial BV2 cell line was a kind gift from Dr. Manisha Patel (University of Colorado Anschutz Medical Campus). Both cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM; Corning 10017CV) supplemented with 10% fetal bovine serum (FBS, GEMINI, 100-500) and 1% penicillin/streptomycin (Corning, 30002CI) at 37°C with 5% CO₂.
Cell transfection was carried out in 24-well plates as described 51 (link). Briefly, RAW264.7 and BV2 cells under approximately 80% confluence were treated with 0.25% Trypsin-EDTA (Corning, 25-053-CI) and then transfected with Lipofectamine 2000 (Invitrogen, 11668019) in suspension with siRNAs specific to mouse CtBP1 (UCUUCCACAGUGUGACUGCGUUAUUUU, 50 nM), CtBP2 (GCCUUUGGAUUCAGCGUCAUAUUU, 50 nM), or both (25 nM each). The transfected cells were incubated in DMEM for 24 h, followed by treatment with 200 ng/mL LPS (Sigma-Aldrich, L3880) for 6 h, and harvested for RNA extraction.

The RAW264.7 macrophage cell line was purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. (Shanghai, China). RAW264.7 macrophages were cultured in a CO₂ incubator with Dulbecco's Modified Eagle Medium (DMEM, Corning) supplemented with 10% fetal bovine serum (FCS, Corning). Bone marrow was flushed from femurs and tibias of C57 BL/6J mice, and bone marrow‐derived macrophages (BMDMs) were generated in vitro with macrophage colony‐stimulating factor (M‐CSF, 20 ng/ml, Novoprotein Co., Ltd.) and cultured in DMEM supplemented with 10% FCS. When cells reached a confluence of approximately 80%, they were starved for 24 h and then treated with TGF‐β1 (Novoprotein, 2, 5, 10, and 20 ng/ml) and P144 (200 μg/ml) as indicated.