Maxima rt

The collected emulsions are processed similarly to the Drop-Seq workflow [7 (link)]. In brief, the emulsion is broken, beads are collected and reverse transcribed with MMLV reverse transcriptase (Maxima RT, Thermo Fisher), unused primers are degraded with Exonuclease I (New England Biolabs), and beads are washed and PCR amplified. The following modifications are incorporated to account for the low number of beads collected. During the emulsion breakage step, a 0.01% v/v solution of Sarkosyl in 6× SSC is used. During the steps leading up to reverse transcription, a 0.01% v/v Tween-20 solution in 6× SSC is used. Following PCR, the cDNA library is split into two fractions following sequential AmPure bead purification at 0.6× and 2.0× volume ratios as performed the Cite-Seq workflow. Six hundred picograms of cDNA in the fraction containing mRNAs is processed using the Nextera XT kit to form a sequencing library. Five hundred picograms of cDNA in the fraction containing amplified well indexes underwent a second round of PCR to add sequencing adapters. Libraries are pooled and sequenced on an Illumina machine.

Genome copy numbers were determined as follows. RNA was extracted from virus stocks using the QIAamp Viral RNA Mini kit (Qiagen) and reverse-transcribed using Maxima RT (Thermo Scientific) according to the manufacturer’s instructions and using the Universal F(A)+6 primer (gcgcgcagcaaaagcagg). Viral cDNA was then quantified by digital droplet PCR using primers targeting the NP segment (MaMN99 NP F: cgacaaagagatcagaagaagga, MaMN99 NP R: tcatcaaatgggtgagacca, GFHK99 NP F: gaaggagagacgggaaatg, GFHK99 NP R: ggctcttgttctctggtatg) and QX200 ddPCR EvaGreen Supermix (BioRad) on a QX200 digital droplet PCR instrument (BioRad). Infectious titers were determined by plaque assay and used to calculate the genome copy:PFU ratio for each sample of virus. Three samples per virus stock were analyzed in this way. The significance of differences between ratios were compared using an unpaired, two-tailed t-test.

Total RNA was isolated from MC after four weeks of culture with the PeqGold Total RNA Isolation Kit (VWR, Radnor, PA, USA). Quality and integrity of total RNA was controlled using NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) and 2100 Bioanalyzer (Agilent Technologies). To prepare a library of barcoded cDNA for bulk 30-sequencing, poly(A)-mRNA was reverse transcribed with Maxima RT polymerase (Thermo Fisher Scientific, Munich, Germany) using oligo-dT primer containing barcodes, unique molecular identifiers (UMIs) and an adaptor. The 5′ ends of the cDNAs were extended by a template switch oligo (TSO) and full-length cDNA was amplified with primers binding to the TSO-site and the adaptor. NEB UltraII FS kit was used to fragment cDNA. After end repair and A-tailing, a TruSeq adapter was ligated and 3′-endfragments were finally amplified using primers with Illumina P5 and P7 overhangs. The library was sequenced on a NextSeq 500 (Illumina).
High-throughput gene expression data analysis was carried out using the R environment for statistical computing. Briefly, genes were normalized using DeSeq2 and a principal component analysis was performed. Next, pairwise comparisons were performed using edgeR and gene set enrichment analysis (GSEA). Additional gene set analysis was performed using the Degust webtool.

Total RNA was isolated from V. cholera colonies as described above. For cDNA synthesis, 4 µg of total RNA was incubated for 5 min at 65°C, to avoid formation of secondary structures, in the presence of dNTPs and random hexamer primers. Then, 200 U of Maxima RT (Thermo Scientific) and RNase inhibitor were added to the mix and further incubated 10 min at 25°C, 30 min at 50°C, and finally 5 min at 85°C, for heat inactivation of the enzyme. For RT control reactions, to verify the absence of contaminant genomic DNA in the RNA samples, H₂O was added instead of Maxima RT. Once the reactions were completed, ∼5 U RNase A (Thermo Scientific) and 2.5 U RNase H (Thermo Scientific) were added to the reaction mixtures and incubated for 30 min at 37°C to remove the remaining DNA. The synthesized cDNA was purified using a QIAquick PCR purification kit (Qiagen), and its concentration was determined spectrophotometrically in a NanoDrop Lite Spectrophotometer (Thermo Scientific). qRT-PCR was performed using an iQ 5 Multicolor Real-Time PCR Detection System (Bio-Rad) with qPCRBIO SyGreen Mix fluorescein (PCR BIOSYSTEMS). Master mixes were prepared as recommended by the manufacturer, with qRT-PCR primers listed in Supplementary file 2 – Supplementary Table 3. For normalization, either gyrA or hfq was used as internal standards.

1 µg of RNA was used for reverse transcription with MaximaRT (Thermo Fischer EP0751) from respective cell lines (HLE, HLF, SNU-387 and FLC-4). 1:10 diluted cDNA was used for qPCR. Primers used for qPCR are listed in Supplementary Data 4. Plasmids containing lincNMR-001 sequence were linearized using BstBI digestion and gel purified. Serial dilutions were made in the range of 0.02 pg – 5 pg. The copy number was calculated using the online tool https://cels.uri.edu/gsc/cndna.html.

Total RNAs were extracted from cells using the NucleoSpin RNA Plus kit (Macherey-Nagel) following the manufacturer’s instructions and subsequently digested with Turbo DNase (Thermo Fisher Scientific). Library preparation for bulk sequencing of poly(A)-RNA was done as described previously^{31 (link)}. Briefly, barcoded cDNA of each sample was generated with a Maxima RT polymerase (Thermo Fisher Scientific) using an oligo-dT primer containing barcodes, unique molecular identifiers (UMIs) and an adaptor. Ends of the cDNAs were extended by a template switch oligo, and full-length cDNA was amplified with primers binding to the template switch oligo site and the adaptor. The NEB UltraII FS kit was used to fragment cDNA. After end repair and A tailing, a TruSeq adaptor was ligated, and 3′-end fragments were finally amplified using primers with Illumina P5 and P7 overhangs. In comparison with Parekh et al.^{31 (link)}, the P5 and P7 sites were exchanged to allow sequencing of the cDNA in read1 and barcodes and UMIs in read2 to achieve a better cluster recognition. The library was sequenced on a NextSeq 500 (Illumina) with 63 cycles for the cDNA in read1 and 16 cycles for the barcodes and UMIs in read2.