Bis(methacryloyloxy)propanol, 2,3-dichloro-4-oxobutenoic acid, 2,3-dibromo-4-oxobutenoic acid, triethyleneglycoldimethacrylate (TEGDMA), Bisphenol A glycidyl methacrylate (BisGMA), camphoroquinone, 2-(dimethylamino)ethyl methacrylate, p-toluenesulfonic acid monohydrate, toluene, sodium bicarbonate, and ethyl acetate were received from Sigma-Aldrich Co. (Milwaukee, WI) without purifications. The Herculite-XRV (particle = 0.7 µm, untreated) glass fillers were received as a gift from Kavo Kerr Dental Specialties (Orange, CA).
P toluenesulfonic acid monohydrate
Manufactured by Merck Group
Sourced in United States, Germany
P-toluenesulfonic acid monohydrate is a chemical compound used in various laboratory applications. It is a white crystalline solid with the chemical formula CH3C6H4SO3H·H2O. The compound serves as a catalyst, pH adjuster, and reagent in chemical synthesis and analysis procedures.
Automatically generated - may contain errors
Lab products found in correlation
Neopentyl glycol, by Merck Group (5 mentions)
Acetic acid, by Merck Group (5 mentions)
Methanol, by Merck Group (5 mentions)
Toluene, by Merck Group (4 mentions)
Phthalic anhydride, by Merck Group (4 mentions)
Sodium bicarbonate, by Merck Group (3 mentions)
Ethyl acetate, by Merck Group (3 mentions)
Tetrahydrofuran, by Merck Group (3 mentions)
3 mercaptopropionic acid, by Merck Group (3 mentions)
4 dimethylaminopyridine, by Merck Group (3 mentions)
Hydrochloric acid (hcl), by Merck Group (3 mentions)
Sodium azide, by Merck Group (2 mentions)
Isophthalic anhydride, by Merck Group (2 mentions)
3 4 ethylenedioxythiophene, by Merck Group (2 mentions)
4 nitroaniline, by Merck Group (2 mentions)
Tert butyl nitrite, by Merck Group (2 mentions)
4 aminobenzoic acid, by Merck Group (2 mentions)
Acetone, by Merck Group (2 mentions)
Benzoyl peroxide, by Merck Group (2 mentions)
N n dicyclohexylcarbodiimide, by Merck Group (2 mentions)
39 protocols using p toluenesulfonic acid monohydrate
1
Synthesis and Characterization of Dental Composite Materials
2
Synthesis of Functional Azide-Containing Monomers
3
Synthesis of Alkoxylated Polymer Resin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 5
13.6 g of a PEG-PPG-PEG block copolymer with —OH group functionality at each terminal end and having 1100 Daltons Mw (0.0124 moles) that is obtained from Sigma-Aldrich, 33.2 g of neopentyl glycol (0.31 moles, Sigma-Aldrich), and 48.7 g of phthalic anhydride (0.33 moles, Sigma-Aldrich) were weighed into a 250 ml 4-necked round bottom flask equipped with a heating mantle, overhead stirrer, temperature sensor, gas inlet, and a Dean-Stark trap with a condenser. The reaction was heated to 100° C. under a nitrogen atmosphere and 0.4 g p-toluene sulfonic acid monohydrate (0.002 moles, Sigma-Aldrich) as catalyst was added. The reaction was heated to 170-180° C. for 6 hours. The alkoxylated polymer resin that was produced was soft and had Mw of 2850 Daltons.
4
Synthesis of Alkoxylated Polymer Resin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 6
13.6 g of a PEG-PPG-PEG block copolymer with —OH group functionality at each terminal end and having 1100 Daltons Mw (0.0124 moles) that is obtained from Sigma-Aldrich, 33.2 g of neopentyl glycol (0.31 moles, Sigma-Aldrich), and 54.5 g of isophthalic anhydride (0.33 moles, Sigma-Aldrich) were weighed into a 250 ml 4-necked round bottom flask equipped with a heating mantle, overhead stirrer, temperature sensor, gas inlet, and a Dean-Stark trap with a condenser. The reaction was heated to 100° C. under a nitrogen atmosphere and 0.4 g p-toluene sulfonic acid monohydrate (0.002 moles, Sigma-Aldrich) as catalyst was added. The reaction was heated to 170-180° C. for 7 hours. The alkoxylated polymer resin that was produced was soft and tacky and had Mw of 2210 Daltons.
5
Fabrication of Serotonin Aptamer Biosensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3,4-Ethylenedioxythiophene (EDOT), polyacrylonitrile (PAN), dimethylformamide (DMF), ferric chloride, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), hexamethyldisilazane (HMDS), 3,4-Dimethoxythiophene, p-toluenesulfonic acid monohydrate (pTsOH·H2O), butylated hydroxytoluene (BHT), tetrahydrofuran (THF), and Sylgard 184 polydimethylsiloxane (PDMS) were obtained from Sigma–Aldrich. Ethanol, toluene, mEthanol, hexane (Hex), hydrochloric acid (HCl), and ethyl acetate (EtOAc) were obtained from Samchun. Sodium hydroxide (NaOH) was purchased from Daejung. (S)-Methyl 2,3-dihydroxypropanoate (Methyl glycerate) was purchased from Combi-Block. AZ5214E was obtained from Clariant. A serotonin aptamer with the sequence 5′-CGACTGGTAGGCAGAT AGGGGAAGCTGATTCGAGCGTGGGTCG[C6 Amine]-3′ was synthesized by Bioneer. Phosphate buffered saline (PBS) pH 7.4 (1 ×) was purchased from Gibco™, and simulated blood serum and artificial CSF were purchased from Biochemazone. All reagents and solvents were used as received without further treatment.
6
Electrochemical Aptamer Biosensor Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All reagents and solvents were used without further purification. 3,4-dimethoxythiophene was purchased from Matrix scientific. 3,4-Ethylenedioxythiophene (EDOT), 3-chloro-1,2-propanediol, p-toluene sulfonic acid monohydrate, toluene, tetrahydrofuran (THF), hexane, 3-mercaptopropionic acid (MPA), 2,2-Dimethoxy-2-phenylacetophenone (DMPA), Sodium Hydroxide (NaOH), Potassium hydroxide (KOH), Tris(2-carboxyethyl) phosphine hydrochloride (TCEP), Methanol (MeOH) and dichloromethane were purchased from Sigma. Potassium tert-butoxide (tBuOK) was purchased from ACROS. Ethanol (EtOH) was purchased through Fisher. Aptamer 5′-HS-(CH2)6-AGACAAGGAAAATCCTTCAATGAAGTGGGTCG-(CH2)7-MB-3′ with a 5′ thiol group as covalent linkage site and 3′ methylene blue (MB) as electrochemical reporter was purchased through Biosearch Technologies, Inc., Platinum/Iridium wires were purchased from A-M systems.
7
Synthesis of PEG-PPG-PEG Block Copolymer Resin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
13.6 g of a PEG-PPG-PEG block copolymer with —OH group functionality at each terminal end and having 1100 Daltons Mw (0.0124 moles) that is obtained from Sigma-Aldrich, 33.2 g of neopentyl glycol (0.31 moles, Sigma-Aldrich), and 46.2 g of phthalic anhydride (0.31 moles, Sigma-Aldrich) were weighed into a 250 ml 4-necked round bottom flask equipped with a heating mantle, overhead stirrer, temperature sensor, gas inlet, and a Dean-Stark trap with a condenser. The reaction was heated to 100° C. under a nitrogen atmosphere and 0.4 g p-toluene sulfonic acid monohydrate (0.002 moles, Sigma-Aldrich) as catalyst was added. The reaction was heated to 170-180° C. for 6 hours. The alkoxylated polymer resin that was produced was soft and tacky and had Mw of 1710 Daltons.
8
Synthesis and Modification of Gold Gratings
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Acetic acid (reagent grade, ≥99%), diethyl ether (≥99.7%), 4-ethynylaniline (97.0%), p-toluenesulfonic acid monohydrate (ACS reagent, ≥98.5%), mercaptosuccinic acid (≥99.0%), cobalt(II) chloride hexahydrate (reagent grade), copper(II) chloride (99%), cadmium chloride hydrate (99.995% trace metals basis), lead(II) chloride (99.999%), mercury(II) chloride (reagent grade, 99%), aluminum nitrate nonahydrate (99.997%), zinc chloride (99.999%), chromium(II) chloride (95%), high-purity water (EMD MILLIPORE), and methanol (≥99.8%) were purchased from Sigma-Aldrich and used without further purification. Gold gratings were prepared according to a published procedure [29 (link)], as shown in Figure S1 (Supplementary Information) , 4-ethynylbenzenediazonium tosylate (ADT-C≡CH) was prepared according to [42 (link)], and the modification procedure was conducted according to [43 (link)].
9
Synthesis of 4-Nitrobenzenediazonium Tosylate
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Acetic acid (reagent grade, ≥99%), diethyl ether, deionized water, methanol (puriss. p.a., absolute, ≥99.8% (GC)), p-toluenesulfonic acid monohydrate (ACS reagent, ≥98.5%), tert-butyl nitrite (90%), 4-nitroaniline (≥99%), and PEDOT:PSS water suspension was supplied from Sigma-Aldrich. 4-Nitrobenzenediazonium tosylate was synthesized according to the published procedure.29 (link)
10
Confocal Imaging of Transfected HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T was maintained in DMEM supplemented with 10% fetal bovine serum (FBS). Every 3 to 4 days, cells were trypsinized, diluted (1 to 5), and plated onto new dish to avoid high confluency. For confocal imaging, cells were plated on a 96-well glass bottom plate (P96-1.5H-N, Cellvis), which was precoated with poly-l-lysine (Sigma), and 150 ng per well of total plasmids were transfected with Lipofectamine 2000 (Life Technologies, 11668027) following manufacturer’s recommended protocol. Actinomycin D (2 to 5 μg/ml, A1410, Sigma), PF9366 (5 to 20 μM, HY-107778, MedChemExpress), and/or ADOX (40 μM, S8608, Selleckchem) were pretreated for 4 hours before imaging. DMSO was used as vehicle control. SAM (S-Adenosyl-L-methionine p-toluenesulfonate, NA04017, Carbosynth) were supplied to PF9366-pretreated cells 1 hour before imaging (3 hours after PF9366 treatment), together with PF9366. p-Toluenesulfonic acid monohydrate (Sigma) was used as vehicle control for SAM.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!