Du530 uv vis spectrophotometer

We collected these blood samples from each individual after their admission to the hospital. The whole blood samples of all participants collected in a test tube containing EDTA were used for genotyping assay. Genomic DNA was isolated from peripheral white blood and concentrated by using GoldMag-Mini Whole Blood Genomic DNA Purification Kit according to the manufacturer's directions (GoldMag Co. Ltd. Xian, China). The extracted DNA was stored at -80℃ until use. We adopted the spectrometry (DU530 UV/vis spectrophotometer, Beckman Instruments, Fullerton, CA, USA) to detect DNA purity. Sequenom MassARRAY Assay Design 3.0 Software was used to design Multiplexed SNP MassEXTEND assay 19 . PCR and extension primers were designed by Sequenom, Inc. Assay Design. EXO-SAP was used to digest PCR-amplified DNA, and then mixed the primer extended by IPLEX chemistry, desalted using Clean Resin (Sequenom) and spotted onto Spectrochip matrix chips. Finally, results were detected by Mass Spectrometer. All samples were genotyped by Sequenom MassARRAY RS1000 according to the manufacturer's protocol. The final data was managed and analysed by Sequenom Typer 4.0 Software 19 , 20 (link).

MMPs play a key role in the process of bone metabolism. A number of studies have revealed that some genes in the MMP/TIMP pathway affect the risk of ONFH. Thus, we selected 5 SNPs of the MMP2 gene based on the minor allele frequencies of more than 5% in the HapMap Chinese Han population: rs1053605, rs243849, rs243847, rs243832, and rs7201.
Whole blood samples of each participant were extracted and placed in anticoagulant tubes. The extraction kit (GoldMag Co. Ltd., Xi’an, China) was used to isolate genomic DNA from the whole blood, and the genomic DNA concentration was then measured by spectrometry (DU530 UV/VIS spectrophotometer, Beckman Instruments, Fullerton, CA). The DNA was subsequently stored at −20 °C until detection. According to the manufacturer agreement, the Sequenom MassARRAY^® RS1000 system (Agena Bioscience Inc., San Diego, CA) was used to perform genotyping, and the Sequence MassARRAY Assay Design 4.0 (Agena Bioscience Inc.) software was used to design a Multiplexed SNP mass-EXTEND assay.^{[20 ]} Data analyses and management were conducted by Sequenom Typer 4.0 Software (Agena Bioscience Inc.).^{[21 (link)]}

SNPs in 3′ UTRs were selected after conducting a literature review. DNA samples were extracted from whole blood using the universal genomic DNA extraction kit (TaKaRa, Kyoto, Japan).27 (link), 28 (link) DNA concentrations were assessed through spectrophotometry (DU530 UV/VIS spectrophotometer, Beckman Instruments, Fullerton, CA, USA). The multiplexed SNP mass EXTEND assay was designed using Sequenom mass ARRAY assay design (version3.0, Agena Bioscience, San Diego, CA, USA).29 (link), 30 (link), 31 (link) SNP genotyping was performed using Sequenom mass ARRAY RS1000.³² The Sequenom Typer 4.0 software was used to analyze the data.32 , 33 (link) Primers for each SNP were shown in Table 5. In total, five SNPs (rs1059394 and rs2847153 in TYMS, rs1044129 in RYR3, rs1053667 in KIAA0423, and rs11337 in GOLGA7) were successfully genotyped.Table 5

Primers Used in This Study

SNP_ID	1st PCRP (5′–3′)	2nd PCRP (5′–3′)	UEP_SEQ (5′–3′)
rs1044129	ACGTTGGATGACCCTGGAGGTATTGGTACG	ACGTTGGATGAGTGGAGCTGCTCTGTTTAG	TAGGTGAATCTCCTCAAATACA
rs11337	ACGTTGGATGCGAAATCCAGTATTAGCACC	ACGTTGGATGTTGAGAGCGCTGTATTTGGG	CATTAAAAGTTTCACTGTCAGA
rs1053667	ACGTTGGATGGGGCAACAAATTGTAGTTTC	ACGTTGGATGAATCTGAGTCACATGGGATG	gtttgGAGAAAAGTCCTGCTCA
rs1059394	ACGTTGGATGGTATCGACAGGATCATACTC	ACGTTGGATGCGACCTGTTGTAATTGCTCC	cATTGCTCCTCATGTCC
rs2847153	ACGTTGGATGTCTTTAAGTAGGCTGGTCCC	ACGTTGGATGAGAAAAGATCTGGGAGGGTG	gCAAAGAAGGGATCAGACT