Genomic DNA (gDNA) isolation and qPCR were performed as previously described.31 (link) Briefly, 2 million cells were pelleted and genomic DNA was extracted using a Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich). Samples corresponding to 700 ng genomic DNA were used for analysis. Each reaction contained 12.5 μL iQ Supermix (Bio-Rad), 40 nM forward and reverse EGFP primer, and 40 nM EGFP probe in a final volume of 25 μL. RNaseP or β-actin was quantified as the endogenous control (TaqMan RNaseP control reagent; Applied Biosystems). Samples were run in triplicate for 3 min at 95°C followed by 50 cycles of 10 s at 95°C and 30 s at 55°C in a LightCycler 480 (Roche Applied Science). Analysis was performed using the LightCycler 480 software supplied by the manufacturer.
Mammalian genomic dna miniprep kit
Manufactured by Merck Group
Sourced in United States
The Mammalian Genomic DNA Miniprep Kit is a laboratory tool used for the rapid isolation of genomic DNA from mammalian cells or tissues. It provides a simple and efficient method for extracting high-quality genomic DNA for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (4 mentions)
Iq supermix, by Bio-Rad (4 mentions)
Taqman rnasep control reagent, by Thermo Fisher Scientific (2 mentions)
Big dye protocol, by Thermo Fisher Scientific (1 mentions)
Lipofectamine crisprmax cas9 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Cas9 protein, by Thermo Fisher Scientific (1 mentions)
Lysis solution, by Merck Group (1 mentions)
Kapa2g taq polymerase, by Roche (1 mentions)
Neutralization buffer, by Merck Group (1 mentions)
Mab3034, by Merck Group (1 mentions)
Bioruptor, by Diagenode (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rpmi medium, by Thermo Fisher Scientific (1 mentions)
Genelute quantifast sybr green pcr kit, by Qiagen (1 mentions)
Mitotracker deep red, by Thermo Fisher Scientific (1 mentions)
15 protocols using mammalian genomic dna miniprep kit
1
Quantitative PCR for EGFP Expression
2
Mammalian Genomic DNA Extraction and Neomycin Resistance Gene Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (gDNA) was isolated from tissues or iPSCs using the Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) according to the manufacturer's instructions. Detection of the neomycin resistance gene was performed using 100 μg of gDNA and primers (5′-GCGTTGGCTACCCGTGATAT-3′; 3′-GGTCTCCCAGACAAGCTTGAACC-5′) as described previously (Nishinakamura et al., 1995 (link)).
3
Quantitative PCR for Luciferase and β-Actin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2.5 × 106 cells were pelleted, and genomic DNA was extracted using a mammalian genomic DNA miniprep kit (Sigma-Aldrich). Genomic DNA concentrations were determined using standard spectrophotometric methods. Samples corresponding to 100 ng genomic DNA were used for analysis. Each reaction contained 12.5 μl iQ Supermix (Biorad), 40 nM forward and reverse primer and 40 nM of probe in a final volume of 25 μl. The following primer/ probes set were used: fLuc sense: 5′-TCACCCACACTGTGCCCATCTACGA and antisense: 5′-CAGCGGAACCGCTCATTGCCAATGG and probe: 5′-[6FAM]TTCATAGCTTCTGCCAACCGAACGGACA[TAM] and β-actin sense: 5′-GAAGAGATACGCCCTGGTTCC and antisense: 5′-TGTGATTTGTATTCAGCCCATATCG and probe: 5′-[6FAM]ATGCCCTCCCCCATGCCATCCTGCGT[TAM]. Samples were measured in triplicate for 5 min at 95°C followed by 50 cycles of 10 s at 95°C and 30 s at 55°C in a LightCycler480 (Roche Applied Science, Vilvoorde, Belgium). Analysis was performed using the LightCycler480 software supplied by the manufacturer.
4
Extraction and Quantification of mtDNA and nDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mtDNA and nuclear DNA (nDNA) were isolated with a Mammalian Genomic DNA Miniprep kit (Sigma–Aldrich). Forward and reverse primers for mtDNA (ND1 (NADH dehydrogenase, subunit 1): Forward 5′-CCTATCACCCTTGCCATCAT-3′/Reverse 5′-GAGGCTGTTGCTTGTGTGAC-3′); and nDNA (S12: Forward 5′-CGTCACCCGTGATTCACCGC-3′; Reverse 5′-CGCGTATGCCACGTGCTAGG-3′) were used. PCRs were conducted and the amplified products were analysed on Ethidium Bromide-stained agarose gels and expected size products were quantified using SigmaScan Pro (version 5) software. The quantification of all target genes was corrected using the internal control S12.
5
Generation of Ndufs3 Knockout B16-F10 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 system was used to introduce a frameshift mutation in Ndufs3 gene in B16-F10 murine melanoma cell line. In detail, Cas9 protein (Invitrogen #A36497) was transfected following manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen #CMAX00015) together with synthetic RNA guides designed by Deskgen and purchased from Synthego. Exon 3 targeting guide TTGTGGGTCACATCACTCCG with PAM sequence GGG was used. Cells were split 48 hours after transfection and DNA was extracted using Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich #G1N350). Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451). In particular, 61°C annealing temperature was used for the PCR reaction, with primers forward CTGTAACTCCAGTCTCAGGGA and reverse CACACTGCAGGGATCACTTG. Manual clonal selection was performed in order to identify the cells with frameshift Ndufs3 mutations, leading to the generation of a pool of clones carrying the homozygous c.148A>G and c.150_151insCT mutations. DNA extraction from 96-well plates was performed using 8 μL of Lysis Solution (Sigma-Aldrich #L3289) and 80 μL of Neutralization Buffer (Sigma-Aldrich #N9784) per sample, following manufacturer’s instructions.
6
UVB-induced DNA Damage Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were treated with vehicle or NOB for 24 h and then exposed to 200 J m−2 of UVB radiation. DNA was purified from cells harvested at the indicated time points using a Mammalian Genomic DNA Miniprep Kit (Sigma). DNA was immobilized on nitrocellulose and analyzed by immunodot blotting with antibodies against cyclobutane pyrimidine dimers (CPDs; Cosmo Bio NM‐DND‐001) and single‐stranded DNA (Millipore MAB3034).
7
Genomic DNA Extraction from Human Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested and washed twice with 10mM Tris-HCl pH 7.4. The cell pellet was then incubated with the lysis buffer. Cells were incubated with 20μl of RNase A (from GeneElute–Mammalian Genomic DNA Miniprep Kit Sigma-Aldrich) for five minutes at room temperature. Afterwards, cells were incubated in three volumes of the lysis buffer (0.5M EDTA, 1% SDS, 1% N-lauryl sarcosine, 1 mg/ml of proteinase K) at 55°C for overnight. The cells were then incubated for 1Hr with an equal volume of Phenol: Chloroform: IAA on a shaker with gentle shaking. After incubation, the cells were centrifuged at the maximum speed of the table top centrifuge for 10minutes. The supernatant was then transferred to a clean tube, and genomic DNA was precipitated using 800μl of isopropanol.
The T47D human cell line was purchased from Sigma (catalogue number: 85102201) and the MCF7 human cell lines were purchased from ATCC (catalogue number: HTB-22D). DNA was prepared using a Zymo Research Kit (catalogue number: D4068).
The T47D human cell line was purchased from Sigma (catalogue number: 85102201) and the MCF7 human cell lines were purchased from ATCC (catalogue number: HTB-22D). DNA was prepared using a Zymo Research Kit (catalogue number: D4068).
8
Mitochondrial Genome Sequencing and Annotation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole genomic DNA was extracted using Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) according to the manufacturer’s protocols. Sanger sequencing of the entire mtDNA was performed following a quality-check protocol as previously described [49 (link)]. Mitochondrial DNA mutations were confirmed using a second PCR reaction. In silico prediction of the pathogenic potential of missense mutations was performed with PolyPhen2 (http://genetics.bwh.harvard.edu/pph2/ ) as previously described [50 (link)]. FASTA files were used as input for MToolBox [51 (link)] in order to annotate mitochondrial variants and related features, which read mapping, post-mapping processing, genome assembly, haplogroup prediction and variant annotation. Nucleotide site-specific variability was estimated on the multi-alignment of the updated healthy genomes reported in HmtDB [52 (link)] and in HmtVar [53 (link)].
9
Quantitative PCR for CD34 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two million cells were pelleted and genomic DNA extracted using a mammalian genomic DNA miniprep kit (Sigma-Aldrich). Standard spectrophotometric methods were used to determine the genomic DNA concentration. Samples corresponding to 250 ng genomic DNA were used for analysis. Each reaction contained 12.5 μL iQ Supermix (Biorad), 40 nmol/L forward and reverse primer (5′ TGCACCCTGTGTCTCAACAT 3′ and 5′ GGCTTCAAGGTTGTCTCTGG 3′ respectively) and 40 nmol/L of tCD34 probe (5′ (6FAM)-GGCCACAACAAACATCACAG-(TAM) 3′) in a final volume of 25 μL. In all cases, RNaseP was used as an endogenous control for normalization (TaqMan RNaseP control reagent, Applied Biosystems, The Netherlands). Samples were run in triplicate for 3 min at 95 °C followed by 50 cycles of 10 s at 95 °C and 30 s at 55 °C in a LightCycler 480 (Roche-applied-science). Analysis was performed using the LightCycler 480 software.
10
DNA Fragmentation and 5mC/5hmC MeDIP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA (gDNA) samples were prepared using the Mammalian Genomic DNA Miniprep Kit (Sigma). Eluted gDNA samples were sonicated to achieve DNA fragmentation with sizes ranging between 200–500 bp using the Bioruptor (Diagenode), with the high setting, with 3X (5X 0:30 On/0:30 Off) repetitions. DNA fragments were confirmed for their integrity by running ~5 μl on 2% agarose gels. For 5 mC IPs, an MeDIP Kit was used following the manufacturer's instructions (Active Motif, Cat. #55009). MeDIP products were subject to qPCR on a qPCR machine (7900HT Fast Real Time PCR System, Applied Biosystems). Primers used are listed in Table S1 . Sample enrichment was relative to equivalent dilutions of sample input DNA, measured as percent enrichment. ΔCt values were obtained relative to the No Template Control (NTC) samples. For 5 hmC MeDIP, the same protocol was followed, but the 5 hmC antibody (Zymo, Cat. #A4001-25), was used in place of the 5 mC antibody, for the pull-down.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!