Total DNA was extracted from the mouse gluteal muscle using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. NADH dehydrogenase 4 (Nd4), D-loop, cytochrome c oxidase I (Cox1), and glyceraldehyde 3-phosphate dehydrogenase (Gapdh) were amplified by realtime PCR using a LightCycler 2.0 (Roche, Mannheim, Germany). Each 10-µl reaction contained 2 mM MgCl2, 0.5 µM of each primer, 1x Light-Cycler DNA Master SYBR Green I (Roche), and 15 ng of DNA template. All primer sequences are listed in Table 1 . The reaction conditions were as follows: denaturation (95℃ for 10 min), amplification for 35 cycles (95℃ for 10 sec; 62℃ for 10 sec; 72℃ for 10 sec), a melting curve program (65℃ to 95℃ with a heating rate of 0.1℃/sec), and a cooling step (40℃). The results are expressed as the ratio of mtDNA to gDNA and compared as previously described [26 (link)].
Lightcycler dna master sybr green 1
Manufactured by Roche
Sourced in Germany, United States, Switzerland
The LightCycler DNA Master SYBR Green I is a real-time PCR reagent kit designed for the detection and quantification of DNA sequences. It contains the necessary components for performing SYBR Green-based real-time PCR reactions, including a DNA polymerase, reaction buffer, and SYBR Green I dye.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (18 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Lightcycler system, by Roche (3 mentions)
Light cycler 480 2 real time pcr machine, by Roche (3 mentions)
Accupower rt premix, by Bioneer (3 mentions)
Oligo dt18, by Bioneer (3 mentions)
Lightcycler nano system, by Roche (3 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Absolutely rna nanoprep kit, by Agilent Technologies (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Oligo dt, by Thermo Fisher Scientific (2 mentions)
Lightcycler, by Roche (2 mentions)
Lightcycler 2.0 system, by Roche (2 mentions)
Lightcycler 96, by Roche (2 mentions)
Lightcycler 96 system, by Roche (2 mentions)
Lightcycler 480 real time pcr system, by Roche (2 mentions)
Improm 2 reverse transcription system, by Promega (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
37 protocols using lightcycler dna master sybr green 1
1
Quantification of Mitochondrial DNA
2
RNA Extraction and RT-qPCR Analysis
3
Quantitative Real-Time PCR for p53 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The p53 mRNA expression was quantified under various conditions using a fluorescein quantitative real‐time PCR detection system (Light Cycler DNA master SYBR Green I; Roche Molecular Biochemicals, Indianapolis, IN, USA). For p53: 5ʹ-TGCTCACCCTGGCTAAAGTT‐3ʹ and 5ʹ‐AATGTCTCCTGGCTCAGAGG‐3ʹ, (product of 208 bp); and for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH): 5ʹ-CAAGGTCATCCATGACAACTTTG‐3ʹ and 5ʹ-GTCCACCACCCTGTTGCTGTAG‐3ʹ (product of 496 bp). Amplification was followed by melting curve analysis to verify the specificity of the amplicon. The levels of p53 mRNA were quantified by using GAPDH mRNA as an internal control. The changes in p53 transcript levels due to treatment were determined by comparing with those of the vehicle control.
4
RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from callus tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA), as described in a previous study [20 (link)]. Reverse transcription reactions were performed by adopting the SuperScript First-Strand Synthesis System (Invitrogen), as described in a previous study [26 (link)]. Messenger RNA expression was calculated as a ratio relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels and expressed relative to V-WT group levels. In brief, real time polymerase chain reaction (RT-PCR) analyses were performed using the LightCycler System (Roche, Indianapolis, IN, USA) to determine the number of cDNA molecules in the reverse transcribed samples. PCR was performed using 2-mL LightCycler DNA Master SYBR Green I (Roche), 0.25 mM of 5′ and 3′ primers, and 2-mL samples or H2O to a final volume of 20 mL. The concentration of MgCl2 was 3 mM. Sample denaturation, amplification, and fluorescence determination were carried out as described in a previous study [20 (link)]. Purified PCR fragments of known concentration were serially diluted and served as external standards for each experiment to determine the number of copies of the targeted DNA in the samples. GAPDH levels in the samples were used to normalize the data. The primer sequence used for the real-time PCR was the same as that described in previous studies (Table 1 ) [20 (link),31 (link)].
5
Quantitative RT-PCR Analysis of Immune Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from liver tissue was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the RNeasy Mini Kit (Qiagen, Venlo, Limburg, The Netherlands). RNA was translated into cDNA using Superscript III Reverse Transcriptase and Oligo (dT) (Invitrogen). Quantitative RT-PCR was performed using a Light Cycler 480 II Real-Time PCR machine (Roche, Nutley, NJ, USA) and LightCycler-DNA master SYBR Green I (Roche). The relative amounts of mRNA for genes of interest were normalized to Ubiquitin. The following primers were used: Ubiquitin, 5′-TGGCTATTAATTATTCGGTCTGCAT-3′, 5′-GCAAGTGGCTAGAGTGCAGAGTAA-3′ CD11c, 5′-ATGGAGCCTCAAGACAGGAC-3′, 5′-GGATCTGGGATGCTGAAATC-3′ GM-CSF, 5′-GCATGTAGAGGCCATCAAAGA-3′, 5′-CGGGTCTGCACACATGTTA-3′ Flt3-L, 5′-CCTAGGATGCGAGCCTTGT-3′, 5′-TGTTTTGGTTCCCAACTCG-3′ M-CSF, 5′-CAACAGCTTTGCTAAGTGCTCTA-3′, 5′-CACTGCTAGGGGTGGCTTTA-3′ IL-10, 5′-CAGAGCCACATGCTCCTAGA-3′, 5′-TGTCCAGCTGGTCCTTTGTT-3′ IL-4, 5′-GAGAGATCATCGGCATTTTGA-3′, 5′-TCTGTGGTGTTCTTCGTTGC-3′ IL-13, 5′-CCTCTGACCCTTAAGGAGCTTAT-3′, 5′-CCTCTGACCCTTAAGGAGCTTAT-3′ IFN-γ, 5′-GGAGGAACTGGCAAAAGGAT-3′, 5′- TTCAAGACTTCAAAGAGTCTGAGG-3′.
6
Quantitative RT-PCR for Immune Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was recovered from FLDCs or splenic DCs using TRIzol reagent (Life Technologies) or RNALater, respectively. Lung tissue was prepared using the mirVana miRNA isolation kit (Life Technologies). RNA was translated into cDNA using Superscript III Reverse Transcriptase and Oligo (dT; Life Technologies). Quantitative RT–PCR was performed using a LightCycler 480 II Real‐Time PCR machine (Roche) and LightCycler‐DNA master SYBR Green I (Roche) and compared to a serially diluted standard of pooled cDNA. The relative amount of mRNA for genes of interest was normalized to GAPDH or beta‐actin. The following primers were used: β‐actin: 5′‐AGAGGGAAATCGTGCGTGAC‐3′, 5′‐ACGGCCAGGTCATCACTATTG‐3′; Gapdh: 5′‐AATGTGTCCGTCGTGGATCT‐3′, 5′‐CCCAGCTCTCCCCATACATA‐3′; Ifit1: 5′‐TCTAAACAGGGCCTTGCAG‐3′, 5′‐GCAGAGCCCTTTTTGATAATGT‐3′; Ifit3: 5′‐TGAACTGCTCAGCCCACA‐3′, 5′‐TCCCGGTTGACCTCACTC‐3′; Mx1: 5′‐TTCAAGGATCACTCATACTTCAGC‐3′, 5′‐GGGAGGTGAGCTCCTCAGT‐3′; Oas1a: 5′‐GCTGCCAGCCTTTGATGT‐3′, 5′‐TGGCATAGATTGTGGGATCA‐3′; and Oasl2r: 5′‐GGATGCCTGGGAGAGAATCG‐3′, 5′‐CAGTTTCGAAGAGCAGGCGA‐3′.
7
qPCR Analysis of Insulin-Like Peptides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was extracted from 50 isolated heads (3 biological replicates) or 30 whole bodies (5 biological replicates) of adult females by using TRIzol (Invitrogen) and RNeasy Mini Kit and RNase-Free DNase Set (QIAGEN), respectively. The first-strand cDNA was synthesized by using the Invitrogen SuperScript II First-Strand Synthesis SuperMix. qPCR was performed in LightCycler DNA Master SYBR Green I (Roche) on LightCycler 480 System (Roche). Primers are following: dilp2 (heads), F: 5’-gtatggtgtgcgaggagtat, R: 5’-tgagtacacccccaagatag; dilp5 (heads), F: 5’-agttctcctgttcctgatcc, R: 5’-cagtgagttcatgtggtgag; rp49 (heads), F: 5’-agggtatcgacaacagagtg, R: 5’-caccaggaacttcttgaatc; dilp2 (body), F: 5’-acgaggtgctgagtatggtgtgcg, R: 5’-cacttcgcagcggttccgatatcg; dilp5 (body), F: 5’-tgttcgccaaacgaggcaccttgg, R: 5’-cacgatttgcggcaacaggagtcg; rpL23 (body), F: 5’-gacaacaccggagccaagaacc, R: 5’-gtttgcgctgccgaataaccac. For each dilps transcript, we normalized message levels relative to rpL23 (whole body) or rp49 (isolated heads) housekeeping genes by using the 2-ΔΔCT. Data were analyzed using t-test.
8
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Life Technologies) according to the manufacturer's instructions. Each sample, containing 2 µg of RNA, was heated at 65℃ for 15 minutes, before addition of reverse transcriptase. cDNA was prepared through incubation at 50℃ for 60 minutes using the DiaStar RT Kit (SolGent, Seoul, Korea), and real-time polymerase chain reaction (PCR) was performed using a LightCycler instrument (Roche Applied Science, Indianapolis, IN, USA). LightCycler DNA Master SYBR-Green I (Roche Applied Science), cDNA template, primer pairs, and 25 mM MgCl2 were added to microcapillary tubes to give a final volume of 20 µL. PCR was conducted for 40 to 50 cycles, each consisting of predenaturation at 95℃ for 10 seconds, 5 seconds at a specific annealing temperature, and primer extension at 72℃ for 20 seconds. The expression level of the target gene was normalized to the β-actin expression level. Melting curves were visually inspected to confirm the specificity of product detection. The primer sequences were as follows: GLP-1r, TCAAGGTCAACGGCTTATTAG (forward) and TAACGTGTCCCTAGATGAACC (reverse); osteocalcin (OC), AGCAAAGGTGCAGCCTTTGT (forward) and GCGCCTGGGTCTCTTCACT (reverse); and alkaline phosphatase (ALP), CCCCCGTGGCAACTCTATCT (forward) and GATGGCAGTGAAGGGCTTCTT (reverse).
9
Quantitative RT-PCR of Transfected Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from stably transfected cells with the TRIzol reagent (15596-026; Invitrogen), and first-strand cDNA was synthesized according to the manufacturer’s instruction (DRR036A; Takara). qRT-PCR was carried out using LightCycler® DNA Master SYBR-Green I as reaction mix (12015099001; Roche, Branchburg, NJ, USA) on the ABI 7300 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) under the following conditions: 95°C for 30 sec to denature cDNA and primers, followed by 40 cycles at 95°C for 5 sec, 60°C for 20 sec and 72°C for 30 sec, followed by a terminal extension for 7 min at 72°C. Gene expression was calculated with the comparative Ct method and normalized against the endogenous levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences are listed in Table I .
10
Quantitative Analysis of Immune Markers in Autoimmune Hepatitis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood was drawn from patients with AIH and volunteers into a tube containing EDTA-2Na and centrifuged to separate PBMCs. RNA was reverse transcribed to single stranded cDNA using the Random Primer, dNTP Mixture (Takara Shuzo Co., Ltd., Shiga, Japan) and RNasin® Ribonuclease Inhibitor (Promega, Madison, WI, USA), according to the manufacturer’s protocol. cDNA was used for quantitative analysis by PCR. Quantitative real time PCR (qPCR) was performed with a LightCycler 2.0 System (Roche Applied Science, Germany) using LightCycler DNA Master SYBR Green I (Roche Applied Science). PCR mixtures contained 0.5 μM sense and antisense primers. Samples were denatured at 95 °C for 10 min, followed by 45 cycles of annealing and extension at 95 °C for 15 s, 60 °C for 5 s, and 72 °C for 10 s. Melting curves were obtained at the end of amplification by cooling the samples to 65 °C for 15 s, followed by further cooling to 40 °C for 30 s. Data were analyzed by the standard curve method for relative quantification using LightCycler analysis software. For qPCR, data were normalized against GAPDH.
| RT-PCR primer | Sequence | |
|---|---|---|
| GAPDH | F | 5′-GGTGAAGGTCGGAGTCAACGG-3′ |
| R | 5′-TGAAGGGGTCATTGATGGCAACA-3′ | |
| CXCR5 | F | 5′-GGTCTTCATCTTGCCCTTTG-3′ |
| R | 5′-ATGCGTTTCTGCTTGGTTCT-3′ | |
| Bcl-6 | F | 5′-GAAGCCCTACAAATGCGAAA-3′ |
| R | 5′-TGACGGAAATGCAGGTTACA-3′ | |
| IL-21 | F | 5′-CCACAAATCAAGCTCCCAAG-3′ |
| R | 5′-CAGGGACCAAGTCATTCACA-3′ |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!