Pet28b

To evaluate the impact of resistance-determinant genes on MICs, bla_OXA–1045 and bla_OXA–213 were cloned into the vector pET28b (MiaoLingBio, Wuhan, China). To make pET28b-OXA1045 and pET28b-OXA213, PCR amplification and vector pET-28b were digested with BamHI and XhoI and then ligated to the pET-28b vector (Invitrogen, Carlsbad, California, United States). As previously described, the generated plasmid was chemically converted into E. coli strain BL21 (Sigma-Aldrich, St. Louis, MO, United States) (Liu et al., 2021 (link)). Potential transformants containing pET28b-OXA1045 were identified on LB agar plates (Sigma-Aldrich, St. Louis, MO, United States) containing 20 mg/L of kanamycin (TransGen, Beijing, China). PCR primers PET28AVF2/PET-VF were used to screen colonies on plates, followed by Sanger sequencing (Supplementary Datasheet 1). The empty vector pET-28b was turned into BL21 for use as a control.
MICs of ampicillin, ampicillin-sulbactam, piperacillin, piperacillin-tazobactam, oxacillin, cefazolin, cefoxitin, cefuroxime, ceftazidime, cefotaxime, imipenem, and meropenem for the transformants containing pET28b-OXA1045 (BL21:pET28b-OXA1045) and pET28b-OXA213 (BL21:pET28b-OXA213) were determined by the broth microdilution method. MICs for ampicillin in the presence of 4 mg/L of sulbactam were also determined based on the methods used to establish MICs for piperacillin-tazobactam.

To produce His-tagged Ecd and SmD3::HA proteins, respective cDNAs were cloned into pET28b (Sigma Cat# 69865) and Gateway pDEST17 (Invitrogen Cat# 11803012) vector, respectively. Recombinant proteins were expressed in BL21 Rosetta (DE3) Escherichia coli cells (Invitrogen Cat# C600003) upon induction with 0.4 mM IPTG (Sigma-Aldrich Cat# I5502-5G) overnight at 16°C and subsequently affinity purified using Ni Sepharose (GE Healthcare Cat# GE17-5268-01). For pull-down assays, 10 μg of purified His::Ecd and His::SmD3::HA protein were incubated either alone or together overnight at 4°C with protein G Dynabeads (Invitrogen Cat# 10004D) coupled to 3 μg of rat-anti Ecd N-term (22 (link)) antibody. Washing steps and subsequent detection via western blotting was carried out as described above.

Primers used in this study were obtained from Thermo Fisher Scientific. The plasmid vector for expression of BafA_Bhe (pET-28b-BH513) was generated in our previous study (19 (link)). For construction of plasmids expressing the passenger domain of B. bacilliformis BafA ortholog candidates, the genomic DNA of B. bacilliformis was purified from 14-day-old cultures on CSB agar using a PureLink genomic DNA mini kit (Thermo Fisher Scientific). Using the genomic DNA as the template, the nucleotides encoding the 25th to 512th amino acids of BARBAKC583_RS02470 and the 25th to 498th amino acids of BARBAKC583_RS02475 were amplified by Platinum SuperFi DNA polymerase (Thermo Fisher Scientific) with the primer sets NheI-RS02470-Fw (TCTCGCTAGCTCAGATTGGTGTGATGTCGTG)–SalI-RS02470-Rv (GACTGTCGACTCATAAAGGATCTGGACTTGGCTGA) and NheI-RS02475-Fw (TCTCGCTAGCGAGGAAAAAAAGCAAGGGGG)–SalI-RS02475-Rv (GACTGTCGACTCATGAAAAATTAGCAGTCTGCATACTC), respectively. The PCR products were digested with NheI/SalI and inserted into the compatible sites of pET-28b (Sigma-Aldrich, St. Louis, MO) by using a Ligation-Convenience kit (Nippon Gene, Tokyo, Japan). The resultant plasmids were designated pET-28b-RS02470 and pET-28b-RS02475. All inserted sequences in the plasmids were confirmed by Sanger sequencing (Eurofins Genomics, Tokyo, Japan).

His-tagged full length PNG protein was expressed in Rosetta 2(DE3) (EMD Millipore, Billerica, MA) using pET28b (EMD Millipore, Billerica, MA) and purified with Ni-NTA Agarose (Qiagen, Valencia, CA) under denaturing condition. Purified His-PNG was injected to rabbits to raise antibodies (Covance, Princeton, NJ). The specificity of the antibody was confirmed by western blots of png mutant extracts.

A translational fusion of the −397 to +30 region of E. coli rne and the coding region of the firefly luciferase (luc) gene (Supplementary Figure S3) was synthesised by GeneArt (Thermo Fisher Scientific, Waltham, MA, USA) and ligated between the XbaI and XhoI restriction sites of pET28b (Novagen, a brand of Merck, Darmstadt, Germany) to generate pET28[rne-luc]. The sequence was confirmed by DNA sequencing. E. coli DH5α was transformed with pET28[rne-luc]. DH5α, pET28[rne-luc] was grown in LB supplemented with 25 µg/mL kanamycin at 37 °C overnight with shaking. Cells were harvested by centrifugation and pET28[rne-luc] was extracted using the NucleoBond Xtra Midi plasmid preparation kit (Macherey-Nagel, Düren, Germany).

The nucleocapsid proteins of SARS-CoV (betacoronavirus lineage B), Pi-Bat CoV HKU5 (betacoronavirus lineage C), and rousettus bat coronavirus (Ro-BatCov HKU9; betacoronavirus lineage D) were obtained as described (2 (link),16 (link)). To produce a plasmid for DcCoV UAE-HKU23 nucleocapsid protein purification, primers 5�?�-CATGCCATGGGCATGTCTTTTACTCCTGGTAAGC-3�?� and 5�?�- CCGCTCGAGTATTTCTGAGGTGTTTTCAG-3�?� were used to amplify the gene encoding the nucleocapsid protein of DcCoV UAE-HKU23. The sequence encoding aa 1�?"672 of the nucleocapsid protein was amplified and cloned into the NcoI and XhoI sites of expression vector pET-28b(+) (Merck KGaA, Darmstadt, Germany). Recombinant nucleocapsid protein was expressed and purified by using the Ni²⁺-loaded HiTrap Chelating System (GE Healthcare Life Sciences, Little Chalfont, UK) according to the manufacturer�?(tm)s instructions. The nucleocapsid protein of MERS-CoV was cloned and purified by using the method described above with primers 5�?�-GGAATTCCATATGATGGCATCCCCTGCTGCACCTC-3�?� and 5�?�- ATAAGAATGCGGCCGCATCAGTGTTAACATCAATCATT-3�?�.

The Bt H1.5 strain, from the Bt collection held at the Universidad Pública de Navarra (Pamplona, Spain) [33 (link),34 (link)] and the Escherichia coli DH5α strain were cultured in Luria-Bertani (LB) medium (1% tryptone, 0.5% yeast extract, and 1% NaCl, pH 7.0) at 28 °C and 37 °C, respectively. E. coli DH5α was used as a host strain for transformation whereas E. coli BL21(DE3) was used for protein expression and grown in 2× YT medium (1.6% tryptone, 1% yeast extract, and 0.5% NaCl, pH 7.0) at 37 °C. The vector pGEM-T Easy (Promega, Madison, WI, USA) was used for routine cloning of PCR products and the expression vector pET-28b(+) (Merck Millipore, Darmstadt, Germany) was used for the production of recombinant proteins.