Redtaq dna polymerase

Co-segregation of the T-DNA insertion site with the mutant phenotype in the T2 progeny was checked by PCR using i) the specific genomic forward (Genotyping-F) and reverse (Genotyping-R) primers to amplify the WT allele (without T-DNA insertion) and ii) one specific genomic primer (Genotyping-F) and the specific T-DNA border primer (T-DNA-R) to amplify the mutant allele (carrying the T-DNA insertion). The primers located upstream and downstream of the T-DNA insertional sites in each line were designed based on sequence information available from SGN Database (http://solgenomics.net/). The sequence of genotyping primers used is listed in Supplementary Table S3. Amplification of genotyping primers was performed in a volume of 30 μl using 25 ng of total DNA, 50 ng of each primer, 0.25 mM dNTPs, 2.5 mM MgCl₂, and 1 U of REDTaq DNA polymerase (SIGMA-Aldrich) in 1X Taq buffer. DNA was amplified under the following thermal cycling conditions: 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 2 min, and a final extension of 5 min at 72 °C. PCR products were analysed in 1% agarose gels in SB buffer (10 mM sodium boric acid) and visualized with ethidium bromide.

PCR amplification of CAG repeats located in exon 1 of HTT in HD cell lines used forward (5′-ATGAAGGCCTTCGAGTCCCTCAAGT CCTTC-3′) and reverse (5′-CTGAGGCAGCAGCGG CTGTGCCTGCG-3′) primers. PCRs were performed in a volume of 25 μl containing 100 ng genomic DNA, 1.6 mM of each dNTP, 4 pmol of each primer, and 0.5 U Q5 DNA polymerase (New England Biolabs). After an initial denaturation of 4 min at 98 °C, 40 cycles of 45 s at 98 °C, 1 min at 68 °C, and 3 min at 72 °C were carried out, followed by a final extension of 10 min. PCR products were resolved in a 7.5% (wt/vol) denaturing polyacrylamide gel, followed by Southern blot analysis using a ³²P-labeled (CTG)₅ oligonucleotide probe. PCR products were then visualized by an Amersham Typhoon phosphor imager as described (49 (link)).
To analyze the expanded CTG repeats derived from Polθ-catalyzed primer extension, DNA bands (³²P-labeled) were excised and eluted from gels, then PCR-reamplified for 35 cycles by REDTaq DNA polymerase (Sigma-Aldrich) using primers 5′-ACGTTGTAAAACGACGGCCA-3′ (forward) and 5′-CATGATTACGAATTC-3′ (reverse), essentially as described above. PCR products were cloned into a pGEM-T vector (Promega) and transfected into E. coli DH5-Alpha (Thermo Fisher). Plasmid DNAs were isolated and subjected to Sanger DNA sequencing (Source BioScience).

Cells were washed with PBS, and total RNA was extracted using Qiagen RNA Isolation Kit (Qiagen, Valencia, CA). Reverse transcription was performed using the High Capacity cDNA Reverse Transcription Kit (AB Applied Biosystems, Carlsbad, CA) according to the manufacturer’s instructions. Twenty ng of cDNA was used in the following PCR reaction using empirically determined conditions to allow a quantitative analysis [15] (link). PCR amplification was performing using REDTaq DNA Polymerase (Sigma) with a program of 95°C for 5 minutes, 35 cycles of 94°C for 30 seconds, 65°C for 1 minute, 72°C for 1 minute, an extension of 72°C for 5 minutes for Hb9 amplification; a program of 95°C for 5 minutes, 23 cycles of 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 90 seconds, and an extension of 72°C for 5 minutes was used for GAPDH amplification. The following reverse and forward primers were utilized: HB9: AGCTGGGCCGGCACCTTCC and CCGCCGCCGCCCTTCTGTTTCTC; GAPDH: TGAAGGTCGGAGTCAACGGA and GATGGCATGGACTGTGGTCAT. PCR products were visualized on an ethidium bromide-stained1.5% agarose gel and the bend intensities under UV light were captured and analyzed with a Chemi-Imager 4400 v5.5 with the Alpha-Ease software. The HB9 expression levels were normalized to that of GAPDH.

Spike-in cytosine-, 5mC- and 5hmC-containing control oligonucleotides were synthesized using unmethylated lambda DNA (Promega) as template by PCR containing dCTP, dmCTP (5mC) or dhmCTP (5hmC), respectively. Regular dCTP was purchased from Promega, and dmCTP and dhmCTP were purchased from Zymo Research. PCR primers for control oligonucleotides are listed below:

C control oligo forward: ATTGTATGTATTGGTTTATTG

C control oligo reverse: TTATCACATTCAAACATTAAT

5mC control oligo forward: TAGATAGTAAATATAATGTGAGA

5mC control oligo reverse: ATAAATCATCAACAAAACACAA

5hmC control oligo forward: GTTTTTTTGAATAATAAATGTTA

5hmC control oligo reverse: TTTATCACCTCTAAAATATATCA

PCR was performed using REDtaq DNA polymerase (Sigma) by following the manufacturer’s instructions.

Site-directed mutagenesis
was performed by amplifying part of the gene by PCR with Taq-polymerase (REDTaq DNA Polymerase, Sigma) using a forward primer
containing the desired mutation and the T7-reverse primer (Table S7). The product, a megaprimer, was subsequently
used to amplify the whole plasmid in a second round of PCR using the Phire Hot Start II polymerase (Thermo Fisher). The product
of the second PCR was digested with DpnI (FastDigest DpnI, Thermo
Fisher) for 30 min at 37 °C. For plasmid amplification, 1 μL
of the DpnI-digested PCR mixture was transformed into electrocompetent E. Cloni cells. The transformed cells were grown on LB agar
plates supplemented with 1% glucose and 100 μg/mL ampicillin.
The next day, colonies were inoculated in 5 mL of LB medium supplemented
with 100 μg/mL ampicillin, then grown overnight at 37 °C.
The cells were pelleted by centrifugation at 4000 rpm for 5 min, and
the plasmid was purified using a GeneJET Plasmid MiniPrep kit (Thermo
Fisher). The purified plasmid was sequenced to confirm the presence
of the desired mutation.

Trizol (Invitrogen) was used to extract total RNA from PDXs and Cell lines. A cDNA library was created using SuperScript III Reverse Transcriptase (Invitrogen). End point PCR was the performed using RedTaq DNA Polymerase (Sigma) and resolved using 2% agarose gel electrophoresis. The primers used are listed in Supplementary Table S1.