Lenticrispr egfp sgrna 1

Manufactured by Addgene

LentiCRISPR- EGFP sgRNA 1 is a plasmid designed for CRISPR-Cas9 gene editing. It contains a single guide RNA (sgRNA) sequence targeting the EGFP gene.

Automatically generated - may contain errors

Lab products found in correlation

Pmd2 g vsv g envelope expressing plasmid, by Addgene (1 mentions) Pspax 2 lentiviral packaging plasmid, by Addgene (1 mentions) Pcdna3 yfp, by Addgene (1 mentions) Pcdna3 ha akt2, by Addgene (1 mentions) Lenticrispr v2 vector, by Addgene (1 mentions)

2 protocols using lenticrispr egfp sgrna 1

CRISPR-mediated PHGDH knockout in SKOV3 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiCRISPR transfer plasmid (Addgene Plasmid 49535), LentiCRISPR- EGFP sgRNA 1 (Addgene Plasmid 51760), PMD2.G VSV-G envelope expressing plasmid (Addgene Plasmid 12259), and PsPAX.2 lentiviral packaging plasmid (Addgene Plasmid 12260) were purchased. The target sequence of the sgRNA is GCTCTGAGCCTCCTTGGTGC (exon 8 of PHGDH). The plasmids were virally transfected into HEK293T cells using polyethylemine (PEI) (Polysciences, Inc) and transduced into SKOV3 cells as previously described (Shalem et al. 2014 (link)). Single-cell colonies of puromycin-resistant cells were selected and validated by western blotting.

Wang Q., Liberti M.V., Liu P., Deng X., Liu Y., Locasale J.W, & Lai L. (2016). Rational design of selective allosteric inhibitors of PHDGH and serine synthesis with in vivo activity. Cell chemical biology, 24(1), 55-65.

+ Open protocol

+ Expand

CRISPR-mediated Knockout of Akt1, NRF1, and Parkin

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

FLAG-AIMP2, pEGFP-AIMP2, FLAG-Parkin, and pEGFP-N1 plasmids have been previously described (Ko et al., 2010 (link); Lee et al., 2013 (link)). The plasmids pMSCV-hyg-FLAG-NRF1 (#34707), pECE-HA-Akt1 (#10841), and pcDNA3-HA-Akt2 (#9016) were purchased from Addgene. Guide RNAs (gRNA) targeting rat Akt1, NRF1, and parkin were cloned into LentiCRISPR v2 vector (Addgene, Plasmid #52961) and validated by sequencing following the protocol provided by the Prof. Zhang’s lab (Shalem et al., 2014 (link)). The targeting sequences for each gene of the cloned gRNAs are as follows: gAkt1 = tgatgaagacagagcggccg; gNRF1 = atctatccgaaagagacagc; gparkin = agtggttgctaagcgacagg. lentiCRISPR-EGFP sgRNA1 (Addgene, Plasmid #51760) was used as a gRNA control. pcDNA3-YFP (Addgene, Plasmid #13033) was used to visualize transfected PC12 cells in gRNA-mediated gene knockout experiments.

Kim H., Huh Y.J., Kim J.H., Jo M., Shin J.H., Park S.C., Ahn J.Y., Lee Y.I, & Lee Y. (2023). Identification and evaluation of midbrain specific longevity-related genes in exceptionally long-lived but healthy mice. Frontiers in Aging Neuroscience, 14, 1030807.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!