Tnfsf11

Dissected tissues were frozen immediately in liquid nitrogen and stored at −80°C. Unless otherwise indicated, the bone gene expression analyses in this article were obtained from lumbar vertebra 5 (L₅). Frozen tissues were homogenized in Trizol Reagent (Life Technologies) and RNA was isolated according to the manufacturer's instructions. One microgram of RNA was used as a template to synthesize cDNA using the High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). RNA isolation and cDNA production were performed in blinded fashion. Relative mRNA levels were determined via multiplex TaqMan quantitative reverse transcription‐PCR (RT‐PCR) using VIC‐labeled Mouse ACTB and FAM‐labeled TaqMan gene expression assays (Applied Biosystems). The following TaqMan Gene Expression probes (Applied Biosystems) were used for quantitative RT‐PCR: Fgf23 (Mm00445621), Il1b (Mm00434228), Il6 (Mm00446190), Tnf (Mm00443258), Cyp27b1 (Mm01165918), Cyp24a1 (Mm00487244), Tnfsf11 (Mm00441906), Fgf6 (Mm01183111), Tigar (Mm00621530), Ccnd2 (Mm00438070), Slc34a1 (Mm00441450), Slc34a3 (Mm00551746), and mouse Actb (Cat. No. 4352341E). Relative mRNA levels were calculated using the ΔCt method.30

Organs and whole bones were harvested from animals, removed of soft tissues, and stored immediately in liquid nitrogen. We prepared osteocyte‐enriched cortical bone by removing the ends of femurs or tibias and then flushing the bone marrow with PBS. We then scraped the bone surface with a scalpel and froze them in liquid nitrogen for RNA isolation. We isolated total RNA using TRIzol (Life technologies), according to the manufacturer's instructions and prepared cDNA using High Capacity first strand cDNA synthesis kit (Life Technologies). We performed quantitative RT‐PCR using the following Taqman assays from Applied Biosystems: Piezo1 (Mm01241549_m1); Tnfsf11 Mm00441906_m1; Tnfrsf11b (Mm00435452_m1); and ribosomal protein S2 (Mrps2) (for, 5′‐CCCAGGATGGCGACGAT‐3′, rev, 5′‐CCGAATGCTGTAATGGCGTAT‐3′, probe, 5′‐FAM‐TCCAGAGCAGGATCC‐NFQ‐3′); human Piezo1 (Hs00207230_m1); human Mrps2 (Hs00211334_m1); and human Actb (Hs03023943_g1). We calculated relative mRNA amounts using the ^∆Ct method (Livak & Schmittgen, 2001 (link)).

Cells or mouse tumors total RNA was extracted using the NZY Total RNA Isolation kit (#MB13402, Nzytech). RNA from human breast tumors was obtained from Biobanco-iMM. DNase I-treated RNA was reverse transcribed using the NZY M-MuLV First-Strand cDNA Synthesis kit (#MB17301, Nzytech) and Oligo (dT)20 primer; and cDNAs were amplified by real-time PCR using TaqMan Gene Expression Master Mix (#4369016, Applied Biosystems) or NZY qPCR Green, ROX (#MB22003, Nzytech). Specific primers included: TNFRSF11A (#Hs00921372_m1, Applied Biosystems), TNFSF11 (#Hs00243522_m1, Applied Biosystems), PGR (#Hs01556702_m1, Applied Biosystems), ESR1 (#Hs01046816_m1, Applied Biosystems), Twist (Fw: 5′-ccggagacctagatgtcattg-3′; Rv: 5′-ccacgccctgtttctttg-3′), Slug (Fw: 5′-ccaaactacagcgaactgga-3′; Rv: 5′-gtggtatgacaggcatggag-3′), Vimentin (Fw: 5′-gaaaacaccctgcaatctt-3′; Rv: 5′-cctggatttcctcttcgtg-3′), N-cadherin (Fw: 5′-tatcgaaggatgtgcatga-3′; Rv: 5′-caggctcactgctctcata-3′), Oct4 (Fw: 5′-ctgagggcgaagcaggagtc-3′; Rv: 5′-cttggcaaattgctcgagtt-3′) and GAPDH (#PPH00150F, SA Biosciences). Gene expression was normalized using the housekeeping gene GAPDH, and relative mRNA expression was calculated using the 2^–ΔΔCt method.