Superscript 3 first strand system

To confirm the effects of the SNP in the CYP19A1, the expression levels of CYP19A1 gene in noncancerous lung were quantified by real-time RT-PCR. The FastPure RNA Kit (Takara Bio, Shiga, Japan) was used to isolate total RNA from the frozen tissue. Levels of CYP19A1 mRNA were measured by real-time RT-PCR. Total RNA (1μg) was reversed transcribed using the SuperScript III First-Strand System (Life Technologies Inc., Rockville, MD, USA). Quantitative RT-PCR reactions were performed on the ABI ViiA^™ 7 instrument using TaqMan^® Universal Master Mix and gene-specific primer mixes (both from ABI): CY19A1 (Hs00903413_m1), The Ct values for each gene were normalized to the housekeeping gene GAPDH (Hs02758991_g1), and the fold change in the transcript level was caluculated using the ΔΔCt method. Expression levels were calculated relative to those from the lung AD cell line H358.

RNA was isolated from 200 μL of serum using QIAamp Viral RNA kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. RNA was reverse transcribed (RT) using SuperScript III First-Strand system (Life Technologies, Gaithersburg, MD) and an HCV-specific reverse-primer; E1 IN Reverse (5′ GTTCATCATCATATCCCATGCCAT 3′, HCV nt. 1281–1304). The RT reaction was performed at 65 °C for 30 minutes. The cDNA was amplified in a 35 cycle, single round polymerase chain reaction (PCR) using Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA). Primers used for cDNA amplification were E1 IN Reverse and HCV primer RC1 (5′ GTCTAGCCATGGCGTTAGTA 3′, HCV nt. 65–84). Each PCR cycle consisted of denaturation at 98 °C for 10 seconds, annealing at 57 °C for 30 seconds and extension at 72 °C for 40 seconds. Amplicons were subsequently sequenced by Illumina-MiSeq deep-sequencing method following standard protocol (Illumina, San Diego, CA)23 (link).

To amplify the coding region of OCA2, we extracted total RNA from the skin of four homozygous WT (+/+) and four amelanistic (amel/amel) snakes using TriReagent Solution (Sigma Aldrich) and we synthesised cDNA with SuperScript III First-Strand System and oligo(dT)₂₀ primers (Life Technologies). Overlapping fragments of OCA2, spanning the complete coding sequence of the OCA2 gene, were PCR amplified from these cDNA samples and sequenced. We amplified (with the Expand Long Template PCR system; Roche Applied Science) the intron in between exons 11 and 12 of the OCA2 gene (primers shown in Supplementary Table S2) from genomic DNA samples of homozygous WT (+/+), amelanistic (amel/amel) and heterozygous (amel/+) corn snakes. PCR products were visualised on 2% agarose gels and sequenced by primer walking.

Cells were collected on day 17 and dissociated with TRIzol reagent. The RNA was extracted from neurospheres and diluted to 1 μg with DAPC-treated water. SuperScript III First-Strand system (Life Technologies) was used to synthesize the cDNA. qPCR was performed in a 20-μl reaction system, which included 4 μl cDNA, 2 μl random primers (Supplementary Table S2), 2 μl ddH₂O and 10 μl 2X SYBR Green RCR Master Mix (Roche). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene.

Total RNA was reverse-transcribed using the SuperScript III First Strand System (Life Technologies). The resultant cDNA was used in qPCR reactions using 7500 Real Time PCR System (Applied Biosystems) with pre-designed TaqMan Gene expression assays for BRD4, BRD2, Bcl-xL, Rad51 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes (Life Technologies). Triplicates CT values were averaged and normalized to GAPDH. The relative expression of each gene was calculated by the ΔΔCT method. Statistical significance was determined by 2-sample Student t tests.