Log In Sign up
The largest database of trusted experimental protocols

Rg 3000

Manufactured by Qiagen
Visit Supplier
Sourced in United Kingdom

The RG-3000 is a real-time PCR cycler designed for sensitive and precise gene expression analysis. It features an advanced optical system and intuitive software for accurate quantification of target sequences.

Automatically generated - may contain errors

Lab products found in correlation

Express qpcr supermix, by Thermo Fisher Scientific (2 mentions) High capacity cdna archive kit, by Thermo Fisher Scientific (2 mentions) Sypro orange dye, by Thermo Fisher Scientific (2 mentions) Sybr premix ex taq, by Takara Bio (2 mentions) Sybr premix ex taq kit, by Takara Bio (1 mentions) Trnzol reagent, by Tiangen Biotech (1 mentions) Reverse transcriptase, by Promega (1 mentions) Reverse transcription kit, by Promega (1 mentions) Sypro orange, by Merck Group (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Rq1 dnase, by Promega (1 mentions) Rneasy mini column, by Qiagen (1 mentions) Lightcycler 480syber green 1 master mix, by Roche (1 mentions)

Close spelling variants of this product

Rotor-Gene RG-3000 (65 citations) Rotor-Gene RG-3000 Real Time PCR System (14 citations) Rotor-Gene RG-3000 machine (7 citations) Rotor-Gene RG-3000 system (6 citations) Rotor-Gene RG-3000 real-time PCR machine (4 citations) Rotor-Gene RG-3000 qPCR cycler (3 citations) Rotor-Gene RG-3000 thermal cycler (2 citations) RG 3000 thermal cycler (2 citations)

9 protocols using rg 3000

1

Quantitative Analysis of clec14a and Flotillin-2

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was prepared using the High-Capacity cDNA Archive kit (Applied Biosystems), from 1 μg of extracted total RNA. qPCR reactions were performed with Express qPCR supermix (Invitrogen) on a RG-3000 (Corbett, Manchester, UK) thermocycler. Primers for human clec14a and flotillin-2 were as previously described.9 (link) Primers for murine clec14a 5′ UTR, CDS and 3′ UTR and murine beta-actin, are as follows: 5′UTR fwd - TTCCTTTTCCAGGGTTTGTG; 5′ UTR rev - GCCTACAAGGTGGCTTGAAT; CDS fwd - AAGCTGTGCTCCTGCTCTTG; CDS rev - TCCTGAGTGCACTGTGAGATG; 3′ UTR fwd - CTGTAGAGGGCGGTGACTTT; 3′ UTR rev - AGCTGCTCCCAAGTCCTCT; mACTB fwd - CTAAGGCCAACCGTGAAAAG; mACTB rev - ACCAGAGGCATACAGGGACA. Relative expression ratios were calculated according to the efficiency adjusted mathematical model.27
PJ N., P L., K K., X Z., DG W., AR V., A B, & R B. (2015). Blocking CLEC14A-MMRN2 binding inhibits sprouting angiogenesis and tumour growth. Oncogene, 34(47), 5821-5831.
+ Open protocol
+ Expand
2

Evaluating hCA IX-c Stability via DSF

Check if the same lab product or an alternative is used in the 5 most similar protocols
Differential scanning fluorimetery (DSF) was used to assay hCA IX-c conformational stability in terms of melting temperature (TM) against a pH range of 3.0–9.5. Samples of purified hCA II and hCA IX-c at a concentration of 0.25 mg/mL were buffer exchanged into a citrate-phosphate buffer adjusted to the desired pH. A citrate-phosphate buffer system was used for varying the pH while keeping the ionic strength constant.29 The pH values selected for these experiments were 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.5. Prior to data collection, samples were incubated with 0.01% Sypro-Orange dye (no. S6651, Invitrogen Inc.) for ~30 min on ice. Melting curve assays were conducted in a quantitative PCR (qPCR) instrument (RG-3000, Corbett Research) with the temperature increasing from 30 to 99 °C, increasing at a rate of 0.1 °C/6 s. Solutions containing only buffer were also assayed in the same manner to use for background subtraction during data processing. The TM was defined as the maximal value of the first derivative (dRFU/dT; change in fluorescence/change in temperature) of the signal that is produced in terms of relative fluorescent units (RFU). Each experiment was performed in triplicate. Results are summarized in Figure 1A and Table S2.
Mahon B.P., Bhatt A., Socorro L., Driscoll J.M., Okoh C., Lomelino C.L., Mboge M.Y., Kurian J.J., Tu C., Agbandje-McKenna M., Frost S.C, & McKenna R. (2016). The Structure of Carbonic Anhydrase IX Is Adapted for Low-pH Catalysis. Biochemistry, 55(33), 4642-4653.
+ Open protocol
+ Expand
3

Quantitative RT-PCR from Plant Roots

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from 5-day-old roots (50 mg) was extracted using TRNzol reagent (Tiangen) and the cDNA was synthesized by reverse transcriptase (Promega). Quantitative real-time PCR was performed using the SYBR Premix Ex Taq kit (Takara) on a Corbett RG3000. EIF4A or UBQ10 were amplified as an internal positive control for real-time–qPCR and ChIP–qPCR, respectively. Experiments were repeated three times independently. Primers are listed in Supplementary Table 1.
Wang H.Z., Yang K.Z., Zou J.J., Zhu L.L., Xie Z.D., Morita M.T., Tasaka M., Friml J., Grotewold E., Beeckman T., Vanneste S., Sack F, & Le J. (2015). Transcriptional regulation of PIN genes by FOUR LIPS and MYB88 during Arabidopsis root gravitropism. Nature Communications, 6, 8822.
+ Open protocol
+ Expand
4

Quantitative Analysis of clec14a and Flotillin-2

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was prepared using the High-Capacity cDNA Archive kit (Applied Biosystems), from 1 μg of extracted total RNA. qPCR reactions were performed with Express qPCR supermix (Invitrogen) on a RG-3000 (Corbett, Manchester, UK) thermocycler. Primers for human clec14a and flotillin-2 were as previously described.9 (link) Primers for murine clec14a 5′ UTR, CDS and 3′ UTR and murine beta-actin, are as follows: 5′UTR fwd - TTCCTTTTCCAGGGTTTGTG; 5′ UTR rev - GCCTACAAGGTGGCTTGAAT; CDS fwd - AAGCTGTGCTCCTGCTCTTG; CDS rev - TCCTGAGTGCACTGTGAGATG; 3′ UTR fwd - CTGTAGAGGGCGGTGACTTT; 3′ UTR rev - AGCTGCTCCCAAGTCCTCT; mACTB fwd - CTAAGGCCAACCGTGAAAAG; mACTB rev - ACCAGAGGCATACAGGGACA. Relative expression ratios were calculated according to the efficiency adjusted mathematical model.27
PJ N., P L., K K., X Z., DG W., AR V., A B, & R B. (2015). Blocking CLEC14A-MMRN2 binding inhibits sprouting angiogenesis and tumour growth. Oncogene, 34(47), 5821-5831.
+ Open protocol
+ Expand
5

RNA Isolation and RT-qPCR of Rice Seedlings

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rice seedlings were harvested and immediately ground in liquid nitrogen, and the total RNA was isolated using TRNzol reagent (http://www.tiangen.com). The first-strand cDNA was synthesized using a Promega Reverse Transcription kit (http://www.promega.com). RT-qPCRs were performed by using SYBR Premix Ex Taq™ (TaKaRa) with a Corbett RG3000. The OsACTIN2 gene was used as an internal control. The primer sequences are listed in Supplementary Table S1.
Qu X., Yan M., Zou J., Jiang M., Yang K, & Le J. (2018). A2-type cyclin is required for the asymmetric entry division in rice stomatal development. Journal of Experimental Botany, 69(15), 3587-3599.
+ Open protocol
+ Expand
6

Isolation and Quantification of KAT1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from 10-day-old seedlings were extracted using TRNzol reagent (http://www.tiangen.com, last accessed 20 March 2014). Reverse transcription was performed using a Promega kit (http://www.promega.com, last accessed 20 March 2014). Amplification of the KAT1 gene was used as an internal control. Real-time quantitative PCR (RT-qPCR) experiments were repeated three times independently. The cDNA was amplified using SYBR Premix Ex Taq™ (TaKaRa) with a Corbett RG3000.
Yang K., Wang H., Xue S., Qu X., Zou J, & Le J. (2014). Requirement for A-type cyclin-dependent kinase and cyclins for the terminal division in the stomatal lineage of Arabidopsis. Journal of Experimental Botany, 65(9), 2449-2461.
+ Open protocol
+ Expand
7

Thermal Stability Assay of RitR Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
1.5 μM (final concentration) of purified RitR wild-type or C128S mutant protein was incubated for 20 minutes at room temperature in the presence of 50 mM HEPES pH 7.2, 150 mM NaCl, 1 mM DTT or 10 mM H2O2 and 1X SYPRO orange (Sigma) fluorescent dye in a total volume of 20 μl. Samples were then heated to 65°C with each reading taken in 0.1°C increments at 570 nm absorbance. Measurements were made using a qRT-PCR machine (RG-3000, Corbett Research).
Glanville D.G., Han L., Maule A.F., Woodacre A., Thanki D., Abdullah I.T., Morrissey J.A., Clarke T.B., Yesilkaya H., Silvaggi N.R, & Ulijasz A.T. (2018). RitR is an archetype for a novel family of redox sensors in the streptococci that has evolved from two-component response regulators and is required for pneumococcal colonization. PLoS Pathogens, 14(5), e1007052.
+ Open protocol
+ Expand
8

Transcriptome Analysis of Tetraploid Plants

Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole ovaries were dissected into liquid nitrogen, and RNA extracted using the RNeasy Mini Kit (Qiagen). RNA was treated with RQ1 DNase (Promega), and the reaction was cleaned up using an RNeasy Mini column (Qiagen). cDNA synthesis was carried out using 1 μg of RNA in a SuperScript III first strand synthesis reaction (Invitrogen). qRT-PCR was carried out on an RG-3000 (Corbett Research) using LightCycler 480 SYBER Green I Master Mix (Roche) with the oligonucleotides listed in Additional file 1: Table S8. The average of two biological and two technical replicates is reported using the ΔΔCt method, with HpUBC21 as a reference gene. Genes were considered differentially expressed if they had >1.5-fold change and a paired ttest P value <0.05. The validation rate of differentially expressed gene models in our transcriptome analysis using qRT-PCR was ~45 %. While low, this likely represents the difficulty in the design of allele-specific primers to D18 predicted gene models within the tetraploid plants. Oligos used for validation of the transcriptome analysis were designed from transcriptome contigs showing the best match to predicted D18 gene models. All qRT-PCR amplicons were sequenced to verify correct amplification.
Rabiger D.S., Taylor J.M., Spriggs A., Hand M.L., Henderson S.T., Johnson S.D., Oelkers K., Hrmova M., Saito K., Suzuki G., Mukai Y., Carroll B.J, & Koltunow A.M. (2016). Generation of an integrated Hieracium genomic and transcriptomic resource enables exploration of small RNA pathways during apomixis initiation. BMC Biology, 14, 86.
+ Open protocol
+ Expand
9

Thermal Stability of Vault Particles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Thermal stability of vault particles was studied using four pHs (pH = 7.5, 50 mM Tris; pH = 6.0, 50 mMHepes; pH = 5.0, NaOAc 50 mM; pH = 4.0, NaOAc). These buffers also contained 50 mM MgCl2 and 75 mM NaCl. Vault particles were diluted in each buffer to a final concentration of 0.2 mg/ml. To each sample, 2.5 μL of 1% Sypro-Orange dye (Invitrogen 140 Inc. S6651) was added to obtain the final reaction volume to 25 μL. The assays were conducted in a qPCR instrument (Corbett Research, RG-3000). A temperature ramp from 25 to 99 °C, increasing 1 degree per minute was used. Lysozyme was run as a positive control at concentrations of 0.3 and 0.5 mg/ml. Melting temperature of samples was determined using the first derivative (dF/dT) of the raw fluorescence data. All these experiments were conducted in three technical replicates.
Llauró A., Guerra P., Kant R., Bothner B., Verdaguer N, & de Pablo P.J. (2016). Decrease in pH destabilizes individual vault nanocages by weakening the inter-protein lateral interaction. Scientific Reports, 6, 34143.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!