Log In Sign up
The largest database of trusted experimental protocols

Vpa 1009

Manufactured by Lonza
Visit Supplier

The VPA-1009 is a laboratory instrument designed for general scientific use. It is a compact, versatile device that can perform various analytical tasks. The core function of the VPA-1009 is to provide reliable and consistent results for research and testing purposes. However, without further details about the specific capabilities and intended applications of this product, I cannot provide a more detailed description while maintaining an unbiased and factual approach.

Automatically generated - may contain errors

Lab products found in correlation

Mouse macrophage nucleofector kit, by Lonza (2 mentions) Pcdna3.1 empty tag, by Addgene (2 mentions) Stat3 c flag prc cmv, by Addgene (2 mentions) Ikk 2 s177e s181e, by Addgene (2 mentions) Nucleofector 2b device, by Lonza (2 mentions) Prl tk renilla reporter plasmid, by Promega (1 mentions) Nucleofector 1 device, by Lonza (1 mentions) Dual luciferase system, by Promega (1 mentions) Pmirglo dual luciferase mirna target expression vector, by Promega (1 mentions) Complete dmem, by Thermo Fisher Scientific (1 mentions) Dextran alexa fluor 647, by Thermo Fisher Scientific (1 mentions) Anti gfp, by Takara Bio (1 mentions) Lipopolysaccharides (lps), by InvivoGen (1 mentions)

4 protocols using vpa 1009

1

Macrophage Transfection and Polarization

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMDMs were transfected with empty vector control (pcDNA3.1-(empty)-TAG, Addgene 138209), constitutively active STAT3 (Stat3-C Flag pRc/CMV, Addgene 8722), or constitutively active IKK-2 (IKK-2 S177E S181E, Addgene 11105) using a mouse macrophage transfection system, according to the manufacturer’s instructions (Lonza, VPA-1009; Mouse Macrophage Nucleofector Kit). Briefly, 1 × 106 cells were combined with 3 μg plasmid DNA individually, or 2.5 μg each together combined in a total volume of 100μL Nucleofector solution and transfected with the Nucleofector 2b Device (Lonza, AAB-1001) per macrophage-specified setting Y-001. Cells were then plated on a sterile 12-well plate and incubated for 12 hours at 37°C in 1 mL of fully supplemented RPMI 1640 and then polarized with LPS and IFN-γ for an additional 12 hours at 37°C. Conditioned media and BMDM lysate RNA were then harvested for ELISA and quantitative RT-PCR, respectively.
Mantsounga C.S., Lee C., Neverson J., Sharma S., Healy A., Berus J.M., Parry C., Ceneri N.M., López-Giráldez F., Chun H.J., Lu Q., Sellke F., Choudhary G, & Morrison A.R. (2022). Macrophage IL-1β promotes arteriogenesis by autocrine STAT3- and NF-κB-mediated transcription of pro-angiogenic VEGF-A. Cell reports, 38(5), 110309.
+ Open protocol
+ Expand
2

Stat1 3' UTR Luciferase Assay

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
pmirGLO dual-luciferase miRNA target expression vector was purchased from Promega. Wild-type, mutant 1, mutant 2 or mutant 1 and mutant 2 3′ UTR of Stat1 gene fragments were synthesized by Twist Bioscience and cloned into the pmirGLO vector. Ythdf2f/f and Ythdf2cKO BMDMs were transfected with the pmirGLO reporter plasmids using a mouse macrophage nucleofector kit (VPA-1009, Lonza) with program Y-001 on a Nucleofector I device (Amaxa). The cells were collected for lysis 24 h after transfection. The mouse pGL4-Ythdf2 reporter plasmid was generated as previously described51 (link). Mouse Stat3 pcDNA3 plasmid was purchased from Addgene (8706). BMDMs were cotransfected with the pGL4-Ythdf2 reporter plasmid and Stat3 overexpression plasmids or an empty vector together with a pRL-TK Renilla reporter plasmid (Promega) for normalization of transfection efficiency. The cells were collected for lysis 24 h after transfection. Luciferase activity was quantified fluorimetrically with the dual-luciferase system (Promega).
Finocchiaro G., Taroni F., Rocchi M., Martin A.L., Colombo I., Tarelli G.T, & DiDonato S. (1991). cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase.. Proceedings of the National Academy of Sciences of the United States of America, 88(2), 661-665.
+ Open protocol
+ Expand
3

Macrophage Transfection and Polarization

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMDMs were transfected with empty vector control (pcDNA3.1-(empty)-TAG, Addgene 138209), constitutively active STAT3 (Stat3-C Flag pRc/CMV, Addgene 8722), or constitutively active IKK-2 (IKK-2 S177E S181E, Addgene 11105) using a mouse macrophage transfection system, according to the manufacturer’s instructions (Lonza, VPA-1009; Mouse Macrophage Nucleofector Kit). Briefly, 1 × 106 cells were combined with 3 μg plasmid DNA individually, or 2.5 μg each together combined in a total volume of 100μL Nucleofector solution and transfected with the Nucleofector 2b Device (Lonza, AAB-1001) per macrophage-specified setting Y-001. Cells were then plated on a sterile 12-well plate and incubated for 12 hours at 37°C in 1 mL of fully supplemented RPMI 1640 and then polarized with LPS and IFN-γ for an additional 12 hours at 37°C. Conditioned media and BMDM lysate RNA were then harvested for ELISA and quantitative RT-PCR, respectively.
Mantsounga C.S., Lee C., Neverson J., Sharma S., Healy A., Berus J.M., Parry C., Ceneri N.M., López-Giráldez F., Chun H.J., Lu Q., Sellke F., Choudhary G, & Morrison A.R. (2022). Macrophage IL-1β promotes arteriogenesis by autocrine STAT3- and NF-κB-mediated transcription of pro-angiogenic VEGF-A. Cell reports, 38(5), 110309.
+ Open protocol
+ Expand
4

Analyzing TIRAP Signaling in Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
WT (C57B/6) and TIRAP KO iBMDM were a gift from D. Golenbock (UMass) and were cultured in complete DMEM (Gibco) containing 10% FBS and 5% L929 conditioned supernatant. Primary BMDM from WT (C57B/6) or TIRAP KO mice (Jax 017629) were prepared as described (Kagan and Medzhitov, 2006 (link)). Cells were stimulated LPS (Invivogen) at 100ng/mL or phosphorothioate-linked CpG DNA (TCCATGACGTTCCTGACGTT (MGW Operon) at 1μM, unless otherwise indicated.
TIRAP alleles were introduced into TIRAP KO iBMDM by retroviral transduction and sorted by FACS to normalize GFP expression. When biotin-based myddosome isolations were performed, TIRAP alleles were introduced in iBMDM stably expressing the biotin ligase BirA. Where indicated, cells were fixed with 2% paraformaldehyde and stained with anti-GFP (Clontech) according to manufacturer’s instructions. Antibody staining was detected with the secondary antibody labeled with Alexafluor-488 and analyzed by confocal microscopy.
Primary BMDM were transfected by nucleofection using mouse macrophage transfection reagent (Lonza VPA-1009) according to manufacturer’s instructions. Cells were imaged 4 hours later by confocal microscopy. Where indicated, dextran-Alexa Fluor 647 (Life Technologies) was used at 10μg/mL.
Bonham K.S., Orzalli M.H., Hayashi K., Wolf A.I., Glanemann C., Weninger W., Iwasaki A., Knipe D.M, & Kagan J.C. (2014). A promiscuous lipid-binding protein diversifies the subcellular sites of Toll-like Receptor signal transduction. Cell, 156(4), 705-716.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!