Cells were transfected with 27 nM of small interfering RNA (siRNA) oligonucleotides (Eurofins, Ebersberg, Germany) for 48 h using Interferin (Polyplus, Illkirch, France) transfection reagent according to manufacturer's instructions. The following siRNA were used: Control CAGUCGCGUUUGCGACUGG, HIF-1β GGUCAGCAGUCUUCCAUGA, KDM5A GAAGAAUUCUAGCCAUACA, BAF155, CUGUAUUCAUGUGAUUGAA.
Sirna oligonucleotides
Manufactured by Eurofins
Sourced in Germany
SiRNA oligonucleotides are short, double-stranded RNA molecules that can be used to silence the expression of specific genes. They work by binding to and degrading the target mRNA, thereby preventing the production of the corresponding protein.
Automatically generated - may contain errors
Lab products found in correlation
Interferin, by Polyplus Transfection (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Lipofectamine ltx with plus reagent, by Thermo Fisher Scientific (1 mentions)
Psuperior puro vector, by Oligoengine (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Rnaimax reagent, by Thermo Fisher Scientific (1 mentions)
8 protocols using sirna oligonucleotides
1
Knockdown of HIF-1β, KDM5A, and BAF155
2
Transfection of AML1/ETO in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Authenticated cell lines were cultured as described previously, and were obtained from the DSMZ (Braunschweig, Germany) between November 2013 and September 2014 (13 ). Catalog numbers of the cell lines are as follows: HeLa (ACC-57), HL-60 (ACC-3), KASUMI-1 (ACC-220), KG-1 (ACC-14), ME-1 (ACC-537), ML-2 (ACC-15), MOLM-20 (ACC-591), MONOMAC-6 (ACC-124), MV4-11 (ACC-102), SHI-1 (ACC-645), SKNO-1 (ACC-690), THP-1 (ACC-16), U-937 (ACC-5). The siRNA oligonucleotides targeting AML1/ETO fusion gene were designed as described and obtained from MWG Eurofins (Ebersberg, Germany) (14 (link)). The pRedAML1/ETO plasmid and the control vectors were described previously (15 (link)). The miR-130a inhibitor and the miScript inhibitor negative control were obtained from Qiagen (Hilden, Germany). The siRNAs and the miRNA inhibitor were transfected into different cell lines by electroporation using the EPI-2500 impulse generator (Fisher, Heidelberg, Germany) at 350 V for 10 ms. The pRedAML1/ETO plasmid and the control vector were transiently transfected into HeLa cells using lipofectamine 2000 (Thermo Fisher Scientific, Dreieich, Germany), respectively. After 48 h, transfection efficiency was evaluated by western blot.
3
Silencing DNA-PK by siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The control non-targeted scrambled oligonucleotide and siRNA oligonucleotides designed to target DNA-PK were purchased from Eurofins MWG Operon (Ebersberg, Germany).
(Sense:[GAUCGCACCUUACUCUGUU]-RNA-[TT]-DNA;
Antisense: [AACAGAUAAGGUGCGAUC]-RNA-[TT]-DNA).
Further, 10,000 cells grown in 6-well plates overnight were transfected with 70 nM scrambled siRNA or 70 nM DNA-PK targeting siRNA using Dharmacon SiPort reagent (Dharmacon, Thermo Fisher Scientific, Loughborough, UK) according to the manufacturer’s instructions. The cells were cultured in a normal growth medium for 48 h before re-plating for the clonogenic toxicity assay. The depletion was confirmed by western blotting.
(Sense:[GAUCGCACCUUACUCUGUU]-RNA-[TT]-DNA;
Antisense: [AACAGAUAAGGUGCGAUC]-RNA-[TT]-DNA).
Further, 10,000 cells grown in 6-well plates overnight were transfected with 70 nM scrambled siRNA or 70 nM DNA-PK targeting siRNA using Dharmacon SiPort reagent (Dharmacon, Thermo Fisher Scientific, Loughborough, UK) according to the manufacturer’s instructions. The cells were cultured in a normal growth medium for 48 h before re-plating for the clonogenic toxicity assay. The depletion was confirmed by western blotting.
4
siRNA Knockdown and Plasmid Rescue Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNA transfections were performed with 50 nM siRNA duplexes using Lipofectamine RNAiMAX (Invitrogen). Samples were collected 60 h after transfection unless otherwise stated. The siRNA oligonucleotides were obtained from Eurofins Genomics (MWG). For annotations and sequences see Supplementary Table S1 . The TCOF1 STTT, S1216A+S1199A and S1216A expression plasmids were previously described (28 (link),29 (link)) and primer sequences used for the generation of the ATM-null construct can be found in Supplementary Table S1 . The shRNA against TCOF1 was generated by insertion of an oligonucleotide into the pSUPERIOR.puro vector (Oligoengine) (28 (link)). Cells were transfected in a 4:1 ratio of shTCOF1 and the rescue plasmid (either TCOF1 WT, TCOF1 STTT, TCOF1 ATM-null, TCOF1 S1216A+S1199A or TCOF1 S1216A) using Lipofectamine LTX with plus reagent (Invitrogen) according to the manufacturer's specifications. After 72 h cells were transfected with gRNAs and collected at indicated time points.
5
Transfections and Plasmid Knockdowns in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfections in HeLa, U2OS, H1299 and A549 were performed using INTERFERin (Polyplus, Illkirch, France) following the manufacturer’s instructions. The HEK293 cells were transfected with 0.12 M CaCl2 and HEPES buffered saline (0.156 M NaCl, 0.375 M Na2HPO4, 10 mM HEPES were mixed with water to the final volume of 400 µL and added to the cells). The cell culture medium was changed 24 h following transfection and the cells were harvested 48 h following transfection. GFP-PBRM1 was a kind gift of Prof. Jessica Downs and was described in [14 (link)]. For DNA transfections, 1 ug of plasmid DNA was transfected per well of a six-well plate. Small INTERFERing RNA (siRNA) oligonucleotides (Eurofins) were transfected at 27 nM. The siRNA oligonucleotide sequences were as follows: control, CAGUCGCGUUUGCGACUGG; PBRM1_A GAAGAAAGCAUUAAGGUAU; PBRM1_B UCAGGACGUCTCAUTAGCGAA; YTHDF2 AAGGACGTTCCCAATAGCCAA.
6
Efficient siRNA Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNA oligonucleotides were purchased from Eurofins MWG used at a final concentration of 7.8 nM. The siRNA transfections were performed using INTERFERin (Polyplus Transfections). All siRNA sequences are listed in Table 1 . Cells were transfected three times according to the INTERFERin protocol with 72hours of growing in between transfections.
7
siRNA Transfection for Gene Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfections were done using RNAiMax reagent (Invitrogen, UK), as outlined in the manufacturer’s instructions. siRNA oligonucleotides were obtained from Eurofins and used at a final concentration of 10 nM. Scr: AAGCAGCACGACTTCTTCAAG and Pin1: CTGGCCTCACAGTTCAGCG and GCTCAGGCCGAGTGTACTA
8
siRNA Knockdown of VHL Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA oligonucleotides were purchased from Eurofins/MWG and used in a stock concentration of 20 μM. siRNAs were transfected using INTERFERin from Polyplus according to the manufacturer's instructions. The oligonucleotide sequences used for siRNA knockdown are the following ones:
siNT (nontargeting): 5′-AAC AGU CGC GUU UGC GAC UGG-3′
siVHL: 5′-GGA GCG CAU UGC ACA UCA ACG-3′
siNT (nontargeting): 5′-AAC AGU CGC GUU UGC GAC UGG-3′
siVHL: 5′-GGA GCG CAU UGC ACA UCA ACG-3′
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!