Seven DEGs in a significantly enriched pathway associated with PAMK alleviation of LPS-induced liver injury in goslings were selected by qRT‒PCR to validate the results of performing high-throughput RNA-seq analysis as described previously. Five liver samples were selected from each group of the same batch, and total RNA was extracted using TRIzol reagent (GK20008, Glpbio, CA) and reverse transcribed according to the instructions of the TaKaRa Reverse Transcription Kit (RR036A, Takara, Beijing, China). Quantitative reverse transcription polymerase chain reaction analysis was performed on a real-time fluorescence quantitative PCR instrument (7500) (Life Technologies, Singapore) using 2 × RealStar Fast SYBR qPCR Mix (A304-01, GenStar, Beijing, China) with the following reaction system: SYBR Green Master Mix 10 μL, RNase Free dH2O 7 μL, F Primer 1 μL, P Primer 1 μL, and cDNA 1 μL. The reaction procedure of quantitative reverse transcription polymerase chain reaction was as follows: predenaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and extension at 72°C for 10 min. The relative expression levels of mRNA of the target genes were calculated using the 2−ΔΔCT method with ACTB as the internal reference gene.
Trizol reagent
Manufactured by GLPBIO
Sourced in United States
TRIzol reagent is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components designed for the isolation of total RNA, DNA, and proteins from a variety of biological samples. The reagent maintains the integrity of RNA while effectively lysing cells and dissolving cell components.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Takara reverse transcription kit, by Takara Bio (1 mentions)
Realstar fast sybr qpcr mix, by GenStar (1 mentions)
Hifair 3 1st strand cdna synthesis supermix for qrt pcr, by Yeasen (1 mentions)
Reverse transcription kit, by Accurate Biology (1 mentions)
Mirna qrt pcr starter kit, by RiboBio (1 mentions)
Faststart universal sybr green pcr master, by Roche (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Transscript first strand cdna synthesis supermix, by Transgene (1 mentions)
Sybr green premix pro taq hs qpcr kit, by Accurate Biology (1 mentions)
Evo m mlv rt premix, by Accurate Biology (1 mentions)
Midetect a track mirna qrt pcr starter kit, by RiboBio (1 mentions)
6 protocols using trizol reagent
1
Validating DEGs in LPS-induced Liver Injury
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described before [16 (link)], Trizol reagent (GLPBIO, Montclair, CA, USA) was used to isolate the total RNA of liver samples, which was reverse-transcribed into cDNA by the Hifair® III 1st Strand cDNA Synthesis SuperMix for qRT-PCR (gDNA digester plus) according to the instruction (Yeasen, Shanghai, China). The cDNA obtained in the experiment was perfromed by HRbio™ qPCR SYBR Green Master Mix (Fujian Herui Biotechnology, Fuzhou, China). The primer sequences used were listed in Table 1 .
3
Quantifying miR-21-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol Reagent (GLPBIO, Montclair, CA, USA) was used to extract RNA. The extracted total RNA concentration was determined, and then the RNA was reverse-transcribed into cDNA using a reverse transcription kit (Accurate Biology, Hunan, China). The miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China) was used to analysis miR-21-5p level, and U6 was used for the internal control for normalization purposes, and U6 was used as a control. Their sequences were as follows: miR-21-5p: AUCACAUUGCCAGGGAUUUCC; U6: forward: CGCTTCGGCAGCACATATAC; and U6: reverse: TTCACGAATTTGCGTGTCATC. The results were evaluated by using the 2-ΔΔCt method.
4
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (GK20008, GLPBIO, USA) was used to extract total RNAs. High-Capacity cDNA Reverse Transcription Kit (Cat#43744967; Thermo Fisher Scientific, Waltham, USA) was used to synthesize cDNA. qRT-PCR analysis was performed using 1 μL cDNA, 1 μL forward primer, 1 μL reverse primer, and FastStart Universal SYBR Green PCR Master (Cat#04913914001; Roche, Switzerland) by a 7500 Fast Real-Time instrument (Roche, Switzerland). The expression levels of the target genes were normalized to GAPDH gene. The primer pair sequences used in the present study are listed in Supplementary Table 1 .
5
Profiling Gene Expression in PBMCs, Nerves, and Spleens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from human PBMCs, EAN rat sciatic nerves and fresh rat splenic MNCs using TRIzol reagent (Glpbio, USA) according to the manufacturer’s guidelines. The cDNA was synthesized using TransScript First-Strand cDNA Synthesis Super Mix (TransGen Biotech) and qPCR was performed in triplicate using FastStart Universal SYBR Green Master Mix (Glpbio) on a CFX ConnectTM Real-Time PCR Detection System (Bio-Rad, USA). The primers used in the study are listed in Additional file 1: Table S2 . The qRT-PCR steps including incubation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min and was performed in duplicate. Relative gene expression was normalized to β-actin gene expression and calculated using the 2−ΔΔCt method.
6
RNA Extraction and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (GLPBIO, Montclair, CA, United States). Reverse transcription for mRNA or circRNA was performed using Evo M-MLV RT Premix (Accurate Biology, Hunan, China) and cDNA amplification was performed using SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, China). Reverse transcription and cDNA amplification for miRNA were performed using miDETECT A Track miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China) according to the manufacturer’s instructions. The primers are listed in Additional file: Supplementary Table S3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!