Alw 2 41 27

To estimate the amount of viral infection that had occurred during the exposure period, medium and cells harvested at the end of the infection were stored at -75°C for the determination of viral content. To evaluate whether viral replication in cultured cells may be affected by blocking ephA2 receptor, the cultured epithelial cells were transfected with ephA2 siRNA or pretreated with ephA2 inhibitor (1 μM, ALW-II-41-27, APExBIO, TX, USA) for 48 hours respectively. Thereafter, cultured cells were incubated with 1 MOI of RV 16 and were harvested in hour: 6, 12, 24, and 48 after infection. Thereafter, viral RNA was isolated with the QIAamp Viral RNA Mini Kit (Qiagen, Ontario, CANADA) and subjected to RT-qPCR using the following primers and probe: forward primer; AGCCTGCGTGGCTGCC; reverse primer: ACACCCAAAGTAGTCGCTCCC; probe: TCCGGCCCCTGAAT.

To analyze whether the ephrinA1/ephA2 signaling may regulate the expression of chemokine and antiviral immune mediators enhanced by human RV 16 and poly (I:C), the cultured epithelial cells were transfected with ephA2 siRNA or pretreated with ephA2 inhibitor (1 μM, ALW-II-41-27, APExBIO, TX, USA) for 48 hours respectively. Thereafter, cultured cells were incubated with 1 MOI of RV 16, poly (I:C) at a concentration of 10 uM, or ephrin A1 (1, 10, 25, and 50 ng/ml, R&D systems, Minneapolis, MN). After 24 hours, cultured cells and supernatants were harvested to evaluate the expression levels of the following mediators; IL-8, IL-6, ENA78, MIP1-α, RANTES, MCP-1, type I (IFN-β) and type III (IFN-λ) interferons, and IFN-stimulated genes such as viperin, Mx, and OAS with RT-qPCR, western blot, and ELISA. Additionally, the expression of downstream signal transducers such as P13K/Akt/NF-κB pathways, and TBK/IKKϵ/interferon regulatory factor 3 (IRF3) pathways was evaluated with western blotting. Furthermore, additional experiments were conducted to investigate whether the inhibition of the TBK/IKKϵ/interferon regulatory factor 3 (IRF3) pathways has an effect on RV-and/or poly(I:C)-induced IFN and ISG expression using MRT67307 (TBK/IKKϵ inhibitor, In vivoGen, CA, USA) and G140 (IRF inhibitor, In vivoGen).