The full-length gC1qR open reading frame (ORF) was subcloned into the pcDNA 3.1 expression plasmid (Invitrogen, Carlsbad, CA). gC1qR sequences were amplified using a specific forward primer which contained a BamHI site; 5′-CCG GTA CCA TGC TGC CTC TGC TGC GCT GCT G-3, and a reverse primer containing a EcoRI site; 5′-CCT CTA GAC TCT GGC TCT TGA CAA AAC TCT TGA GG-3. The PCR product was digested with BamHI and EcoRI and ligated into pcDNA 3.1expression plasmid. The resulting pcDNA3.1-gC1qR vector was then transfected into human colonic NCM 460 epithelial cells.
Pcdna3.1 expression plasmid
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PcDNA3.1 is an expression plasmid designed for the expression of recombinant proteins in mammalian cells. It contains a strong cytomegalovirus (CMV) promoter, which drives the expression of the gene of interest. The plasmid also includes a neomycin resistance gene for the selection of transfected cells.
Automatically generated - may contain errors
Lab products found in correlation
Ni sepharose histrap ff column, by GE Healthcare (3 mentions)
Expi293 expression system, by Thermo Fisher Scientific (3 mentions)
Superose 6 increase 10 300 gl column, by GE Healthcare (3 mentions)
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Lipofectamine reagent, by Thermo Fisher Scientific (1 mentions)
Pgl3 basic, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Glomax 96 microplate luminometer, by Promega (1 mentions)
Pact2, by Takara Bio (1 mentions)
Pgbkt7 p53, by Takara Bio (1 mentions)
Pgbkt7, by Takara Bio (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Pegfp n1, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Luciferase assay reagent, by Promega (1 mentions)
Transit 2020 transfection reagent, by Mirus Bio (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Lonsera (1 mentions)
Peasy t3 cloning vector, by Transgene (1 mentions)
Mouse anti gapdh monoclonal antibody, by Beyotime (1 mentions)
18 protocols using pcdna3.1 expression plasmid
1
Subcloning and Transfection of gC1qR
2
HIV-1 Env Plasmid Construction and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The vesicular stomatitis virus G (VSV-G)-encoding plasmid was previously described [20 (link)]. The sequence of full-length clade B HIV-1JRFL Env and clade A HIV-1BG505 (N332) were codon-optimized (GenScript) and cloned into the pcDNA3.1(-) expression plasmid (Invitrogen, Rockford, IL, USA) [21 (link),22 (link)]. The plasmids expressing full-length S375W or cleavage-deficient (Cl-) (R508S/R511S) HIV-1JRFL Env were previously described [9 (link)]. The R508S/R511S mutations were introduced into the full-length HIV-1JRFL Env S375W by overlapping the PCR to generate the S375W Cl- mutant. The presence of the desired mutations was confirmed by automated DNA sequencing. pSVIIIenv-expressing full-length HIV-1YU2 Env and Tat-expressing plasmid pLTR-Tat were previously described [23 (link)]. Transmitted/Founder (T/F) and chronic infectious molecular clones (IMCs) of patients CH058, CH077, RHGA, STCO1, and ZM246F-10 were inferred, constructed, and biologically characterized, as previously described [24 (link),25 (link),26 (link),27 (link)]. The IMCs encoding for the HIV-1 reference strains JRFL, YU2, and BG505 (T332N) were described elsewhere [28 (link),29 (link),30 (link),31 (link)]. Expression plasmids for CH040, RHGA, STCO1, CH198, and ZM246F-10 Env were generated by PCR amplification, inserting the respective Env genes into pCAGGS via EcoRI/XmaI.
3
Constructing and Characterizing Mutant HPV-16 E2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length HPV-16 E2 open reading frame (ORF) was constructed in-frame into the pcDNA 3.1 expression plasmid (Invitrogen, Carlsbad, CA) by PCR amplification using the BamHI and EcoRI restriction sites according to the pBR322 reference clone. Primer-F (5′-GAT GGA GAC TCT TTG CCA ACG-3′) and Primer-R (5′-TCA TAT AGA CAT AAA TCC AGT AGA C-3′) were used to clone the HPV-16 E2. The mutant HPV-16 E2 plasmid was created by PCR mutagenesis using the Primer-F (5′-GAT GGA GAC TCT TTG CCA ACG-3′) and mutant Primer-R (5′-TCC CAT TCT CTG GCC TTG TAA ATA GCA CA TGC TAG-3′), where the mutated codons are denoted in bold and italic. The HPV-16 E2 mutant reduced DNA replication activity and transactivation regulation [13 (link)]. The resulting pcDNA-HPV-16 E2 vector and mutant HPV-16 E2 vector were then transfected into C33a and SiHa cells, respectively. Twenty-four hours after plating, the cells were serum starved in RPMI-1640 medium containing 0.5% FBS for an additional 24 h until the cells became quiescent. Following serum starvation, pcDNA-HPV-16 E2 was transfected into the cells (90% confluent) at passage numbers 6, 9 and 12 using Lipofectamine™ reagent (Life Technologies, Inc.) according to the manufacturer’s protocol. Reporter gene levels were normalised to the amount of total protein, and each experiment was independently performed three to five times.
4
Overexpression and Silencing of SULF2 in LX2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant plasmids expressing full-length SULF2 cDNA cloned into the pcDNA3.1 expression plasmid (Invitrogen, Carlsbad, CA, USA) were used as described previously [30 (link)]. Geneticin-resistant clones were isolated and expanded. Stable transfections of the LX2 cell line using plasmids expressing short hairpin RNA (shRNA) sequences targeting the SULF2 mRNA cloned into the vector pSS-H1p were also performed. The target sequences used for SULF2 shRNA constructs were shRNA-a (AAGTACGTCCACAACCACA) and shRNA-b (AATGTGACTGTCACAAAAT). Constructs containing scrambled target sequences were used as controls.
5
Cloning and Transfection of PSGR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PSGR was cloned into pcDNA3.1 expression plasmid (Invitrogen) using specific primers (pcDNAPSGR-F: 5′-TTTTCTAGAGTCGACAGTGTGACCTCACCCTCTCCAGTC-3′; pcDNA-PSGR-R: 5′-TGGAAGCTTAAGGGTCACTTGCCTCCCACAG-3′); the RTPS1 plasmid (for membrane localization) was a gift from Dr H Matsunami (Duke University, Durham, NC, USA), and NF-κB-Luc (SA Biosciences, Qiagen, Valencia, CA, USA) and pGL3-Basic (Promega) were purchased. HEK293 cells were cultured in Dulbecco's modified Eagle's medium (Hyclone) with 10% FBS. They were seeded (5000 cells per well) in 24-well plates and transfected with 0.8 μg DNA (pcDNA/PSGR, RTPS1 and luciferase plasmid) with Lipofectamine 2000 for 7 h and left incubating for 48 h. Afterwards, cells were serum starved for 3 h in Dulbecco's modified Eagle's medium with 0.5% FBS and subsequently stimulated with 10% FBS as described for specific experiments.
6
Transcriptional Regulation of Cyp19a1 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK 293T and COS7 cell lines were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM of l -glutamine, 100 U/ml of penicillin, and 0.1 mg/ml of streptomycin in 5% CO2 and cultured at 37°C. The confluent cells were seeded in a 24-well plate. The transfection rate was maintained at ~ 90% at the time of transfection. The specific experimental components were as follows: 1) 250 ng of complete 5′ upstream or deletion constructs (normal and mutated) of cyp19a1a and cyp19a1b promoters cloned into the pGL-4.10 (firefly luciferase) vector and 2) 200 ng of pcDNA3.1 expression plasmid (Invitrogen, Carlsbad, CA, USA) containing ORF cDNAs encoding SF-1 and FOXL2. A 5 ng/well of Renilla luciferase (CMV) vector (Promega, Madison, WI, USA) was used as an internal control. Luciferase assays were performed 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega). Renilla luciferase activity was used to normalize firefly luciferase activity. Luminescence was measured using a GloMax®96 microplate luminometer (Promega). The plasmids used in the transfection experiments were prepared using an Endo Free Plasmid Isolation Kit.
7
Molecular Cloning and Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The parental pCS2+ vector was kindly provided by Sergei Tevosian (Dartmouth Medical School, Hanover, NH). pCS2+FOG-2 was kindly provided by Alan Cantor (Children’s Hospital, Boston, Massachusetts). pcDNA3-Nkx2.5 was kindly provided by Mona Nemer (University of Ottawa, Canada). Human GATA-4, Art27 and Art27/GAL(DBD) were cloned into the pCS2+ expression plasmid. The BNP, ANP and αMHC luciferase reporter constructs, GATA-1 and GATA-6 were cloned into the pcDNA3.1 expression plasmid (Invitrogen). FOG-2 and Art27 GST fusions were created by subcloning into pDEST15 (Gateway Technology, Invitrogen). FOG-2, FOG-2 (856–1156), GATA-4, GATA-4 1–216, GATA-4 217–440, GATA-4 N-finger and GATA-4 C-finger were created by subcloning into pGBKT7 (Clontech). Art27 was subcloned into pACT2 (Clontech). pGBKT7-p53, pGADT7-T antigen, and pGBKT7-Lamin C were purchased from Clontech. pGEM-T:easy vector was purchased from Promega.
8
Overexpression and Knockdown of Salusin-α in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to a previous protocol [16 (link)], the 84-bp human salusin-α gene (synthesized by Sangon Biotech Co., Ltd., Shanghai, China) was inserted into compatible enzyme restriction sites (XhoI and BamHI) of pEGFP-N1 (Invitrogen Life Technologies, Carlsbad, CA, USA) to generate pEGFP-salusin-α. The forward primer was TGTGGGATCCATGATTTACACAATGAAG, and the reverse primer was TATACTCGAGCGACATAGGCATGAAATGCTATC. The polymerase chain reaction (PCR) product of the salusin-α gene was digested with restriction enzymes BamHI and XhoI, and the desired fragment was cloned into the pcDNA3.1 expression plasmid (Invitrogen Life Technologies) to generate pcDNA3.1-salusin-α (pc-salusin-α), which the salusin-α gene could be overexpressed by the pc-salusin-α plasmid transfected cells. Similar to our original study, the RNA interference psiHIV-U6-salusin-α (si-salusin-α) recombinant was constructed as described using a Lenti-Pac lentiviral packaging kit (GeneCopoeia, MD, USA). The salusin-α of si-salusin-α indicated that the interference target sequence of salusin-α gene was tccggcactgcgtgctcaa. The si-salusin-α transfected cells might inhibit the expression of the salusin-α gene. Constructed plasmids were confirmed by DNA sequencing. High-purity plasmids were prepared on a large scale in the experiments described below.
9
Transfection and Luciferase Assay for Androgen Receptor Mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length human wild type AR was cloned into pcDNA3.1 expression plasmid (Invitrogen, Waltham, MA, USA) with a CMV promoter. The T878A mutant (T878A-AR) was generated with the Quikchange Mutagenesis Kit (Stratagene, San Diego, CA, USA) using hARWT plasmid as a template. Androgen-starved PC3 cells were seeded in 96-well plates (3000 cells/well) in RPMI 1640 + 5% CSS for 24 h followed by transfection with 50 ng of hARWT or hART878A along with 50 ng of ARR3tk-luciferase reporter construct [56 (link)] (100 ng total plasmid DNA) and 0.3 µL/well TransIT20/20 transfection reagent (TT2020, Mirus, Madison, Wisconsin, WI, USA) for 48 h. Cells were treated with increasing amounts of test compound (0.1% final DMSO concentration) and 0.1 nM R1881 for 24 h. Cell lysis was carried out with 60 µL 1X passive lysis buffer/well (Promega, Madison, Wisconsin, WI, USA). The luminescence from 20 µL of cell lysate and 50 µL of Luciferase assay reagent (Promega, Madison, Wisconsin, WI, USA) was recorded on a TECAN M200pro plate reader.
10
Overexpression of FoxO1 in SiHa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pcDNA 3.1 expression plasmid (Invitrogen, Carlsbad, CA) expressing pcDNA3.1-FoxO1 vector was created at Hangzhou Hibio Bio-tech Co., Ltd. (Hangzhou, Zhejiang, China). The pcDNA3.1 empty vector was chosen as a negative control. FoxO1: Primer-F: 5′-GCG GGC TGG AAG AAT TCA AT -3′ and Primer-R: 5′-TCC AGT TCC TTC ATT CTG CA-3′. The PCR product was digested with BamHI and EcoRI and ligated into pcDNA 3.1 expression plasmid. The resulting pcDNA3.1-FoxO1 vector or pcDNA3.1 empty vector was then transfected into SiHa cells using Lipofectamine 2000 according to the manufacturer's instructions. Brie y, before transfection, the SiHa cells were serum starved for 24 h, 500 pmol of pcDNA3.1-FoxO1 vector and 10 μL of Lipofectamine 2000 were diluted in 750 μL of OptiMEM (Life Technologies, Gaithersburg, MD, USA). The solution was pre-incubated for 45 min at 37 °C, then overlaid onto the SiHa cells for 2 h, nally, 2 ml of growth medium (20% foetal bovine serum) were added for further cultured.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!