GAT1, PTEN and MeCP2 3´UTR fragments were amplified from genomic DNA using a Q5 High-Fidelity Taq Polymerase, digested with NheI and NotI and cloned in the pmirGLO Dual-Luciferase reporter vector (Promega GmbH, Mannheim, Germany)). All plasmids were sequenced before use. The following primers were used for cloning of GAT1, PTEN and MeCP2 fragments containing a predicted miR-132 binding site: GAT1_fwd: atattagctagccgaccaccacttgatgtctg and GAT1_rev: atattagcggccgcaaaatgcccttttcctgtg; PTEN_fwd: atattagctagctgtgtaatcaaggccagtgc and PTEN_rev: atattagcggccgctcttttttttgtgtgcag; MeCP2_fwd: atattagctagcaaatcgacgcccgagttag and MeCP2_rev: atattagcggccgcgaaaattcctttcacccacca. Plasmids were co-transfected with the miR-132 mimic or a negative control (C.elegans miR-67 mimic) into Hela cells using DharmaFECT Duo transfection reagent (GE Healthcare Dharmacon Inc., Lafayette, CO, USA) according to the manufacturer’s protocol. Firefly luciferase activity was assessed as previously described27 (link) using the Renilla-Glo Luciferase System (Promega) according to the manufacturer’s protocol.
Renillaglo luciferase system
Manufactured by Promega
The RenillaGlo Luciferase system is a bioluminescent reporter assay designed for the detection and quantification of Renilla luciferase activity in cell-based assays. The system utilizes the natural substrate of Renilla luciferase, coelenterazine, to generate a luminescent signal that can be measured using a luminometer or plate reader.
Automatically generated - may contain errors
Lab products found in correlation
Caspase glo 3 7 assay, by Promega (2 mentions)
Taxol, by Merck Group (2 mentions)
Recombinant ifnαa, by R&D Systems (2 mentions)
Phage nfkb ta luc ubc dtomato w construct, by Addgene (2 mentions)
Pgl4.82 renilla luciferase reporter, by Promega (2 mentions)
Lego c2 mcherry vector, by Addgene (2 mentions)
Recombinant tnf α, by R&D Systems (2 mentions)
Pmirglo dual luciferase reporter vector, by Promega (1 mentions)
Dharmafect duo transfection reagent, by Horizon Discovery (1 mentions)
3 protocols using renillaglo luciferase system
1
Evaluating miR-132 binding to 3'UTRs
2
Quantifying Apoptosis and NF-κB Activity in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cancer cells were treated with 10 units/ml (39 u/ng) recombinant IFNαA (R&D Systems) or 10 pg/ml recombinant TNFα (R&D Systems) in combination with carboplatin or Taxol (Sigma-Aldrich) for 24 h. Apoptosis was quantified by Caspase-Glo 3/7 assay (Promega). For NFκB reporter assays, the NF-κB responsive sequence from the pHAGE NFKB-TA-LUC-UBC-dTomato-W construct (Addgene)45 (link) was cloned into a pGL4.82 Renilla luciferase reporter (Promega). Cancer cells were co-transfected with this vector and a LeGO-C2 mCherry vector (Addgene). Renilla luciferase activity was determined using RenillaGlo Luciferase system (Promega). Red fluorescence signal was used to normalize transfection efficiency.
3
Quantifying Apoptosis and NF-κB Activity in Cancer Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!