The largest database of trusted experimental protocols

Total rna isolation kit v2

Manufactured by Vazyme
Sourced in China

The Total RNA Isolation Kit V2 is a product designed for the isolation of total RNA from various sample types. It utilizes a silica membrane-based technology to efficiently capture and purify RNA molecules. The kit provides a streamlined workflow for the extraction of high-quality total RNA, suitable for downstream applications such as RT-qPCR, RNA-seq, and other RNA-based analyses.

Automatically generated - may contain errors

5 protocols using total rna isolation kit v2

1

Quantitative Analysis of mRNA Levels in S. aureus

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from S. aureus RN450 and graSFS strains using Total RNA Isolation Kit V2 (Vazyme, Nanjing, Jiangsu, China, cat.# RC112-01) according to the manufacturer’s instructions. Reverse transcription was performed with Hifair® III 1st Strand cDNA Synthesis SuperMix (Yeasen, Shanghai, China, cat.# 11141ES10). Quantitative PCR was performed with SYBR green master mix (Yeasen, Shanghai, China, cat.# 11201ES03). Standard curve was generated by serially diluting the pOS1-mprF or pOS1- dlt plasmids (101-108 copies) and determining the corresponding cycle threshold. According to the standard curves, the mRNA copies of each sample were calculated and normalized to internal control (16S rRNA) of each S. aureus sample before mRNA abundance from different strains treated under the same condition or from the same stain undergoing different treatment was compared.
+ Open protocol
+ Expand
2

RNA Extraction and RT-qPCR Analysis of Antioxidant Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
For RNA extraction, ground lung tissue and BEAS-2B were utilized. Total RNA was extracted using the Total RNA Isolation Kit V2 (Vazyme, China), and cDNA was produced using the HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme, China). RT-qPCR was performed on an ABI 7500 thermocycler (Applied Biosystems, Foster City, CA, USA). The mRNA expression levels of GPX4 and ACSL4 were assessed using the SYBR Green PCR Master Mix (Vazyme). The suitable primers were summarized in Table 1. The relative expression levels of mRNA were reported as fold change compared to levels detected in controls via the ΔΔCt method.

PCR primer sequence

GenesPrimer sequence
Hsa-GPX4F:CCGCTGTGGAAGTGGATGAAGATC
R: CTTGTCGATGAGGAACTGTGGAG
Hsa-ACSL4F: TCTGCTTCTGCTGCCCAATT

Has-IL-6

Has-TNFα

R: CGCCTTCTTGCCAGTCTTTT

F: GGTGTTGCCTGCTGCCTTCC

R: GTTCTGAAGAGGTGAGTGGCTGTC

F: TGGCGTGGAGCTGAGAGATAACC

R: CGATGCGGCTGATGGTGTGG

Hsa-β-ACTINF: TGGCACCCAGCACAATGAA
R: CTAAGTCATAGTCCGCCTAGAAGCA
Rat-GPX4F: GGCAGGAGCCAGGAAGTAAT
R: TGGGCATCGTCCCCATTTAC
Rat-ACSL4F: GACAGAATCATGCGGTGCTG
R: TAACCACCTTCCTGCCAGTC
Rat-β-ACTINF: CGCGAGTACAACCTTCTTGC
R: CCTTCTGACCCATACCCACC
+ Open protocol
+ Expand
3

RNA Extraction and qRT-PCR Analysis of Macrophages and Tumor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from macrophages or tumor cells using Total RNA Isolation Kit V2 (Vazyme, Cat# RC112-01). Reverse transcription from RNA to cDNA use Hiscript Reverse Transcriptase (Vazyme, Cat# R302-01). PCR reactions were performed on a CFX96 Real-Time PCR System (Bio-Rad Laboratories) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Cat# Q711-02). All the primers for qRT-PCR used in this study were shown in Supplementary Table 2.
+ Open protocol
+ Expand
4

RNA Extraction and Real-Time RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue and cellular RNA was extracted using Total RNA isolation Kit V2 (Vazyme), and real-time reverse transcriptase-PCR was performed.
+ Open protocol
+ Expand
5

Total RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells using the Total RNA Isolation Kit V2 (Vazyme, China), and Complementary DNA (ctDNA) was synthesized by the HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme, China). In addition, RT-qPCR was conducted on an ABI 7500 thermocycler (Applied Biosystems, Foster City, CA, USA) using the SYBR Green PCR Master Mix (Vazyme, China), with appropriate primers were listed in Additional File 2. The relative expression levels of mRNA were reported as fold change compared to levels detected in controls via the ΔΔCt method.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!