Mesa fast qpcr

Manufactured by Eurogentec

Sourced in United States

The Mesa Fast qPCR is a real-time PCR system designed for fast and precise quantification of DNA and RNA targets. It features a compact design and rapid thermal cycling capabilities to enable efficient high-throughput nucleic acid analysis.

Automatically generated - may contain errors

Lab products found in correlation

Agilent 2100 bioanalyzer, by Agilent Technologies (7 mentions) Agilent rna 6000 nano kit, by Agilent Technologies (7 mentions) Stepone plus real time pcr system and software, by Thermo Fisher Scientific (6 mentions) Reverse transcription system kit, by Promega (6 mentions) Tripure reagent, by Roche (6 mentions) Cfx manager 3, by Bio-Rad (2 mentions) Cfx96 real time pcr system, by Bio-Rad (2 mentions) Rneasy mini kit, by Qiagen (1 mentions) Tri reagent, by Merck Group (1 mentions) Validated primers, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) 7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions) Taqman fluorogenic detection system, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

MESA FAST qPCR MasterMix Plus for SYBR® Assay (4 citations) Mesa Fast qPCR MasterMix (2 citations) MESA Fast SYBRGreen I qPCR Master Mix (2 citations)

8 protocols using mesa fast qpcr

Quantitative Gene Expression Analysis in Mouse Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using TRI reagent (Sigma). Quantification and integrity analysis of total RNA was performed by running 1 μl of each sample on an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). RNA was purified using an RNeasy Mini Kit (Qiagen) and reverse transcribed using a high-capacity cDNA reverse transcription kit (Life technologies). Gene expression of POMC, NPY, AgRP, Pax4, Pax6, Foxa1, and Foxa2 was quantified using 7900HT Fast Real-Time PCR System and TaqMan fluorogenic detection system (Applied Biosystems). Validated primers were purchased from Applied Biosystems. Comparative real-time PCR was performed in triplicate and data was analyzed according to the 2^−ΔCT method normalized to 18S.
Real-time PCRs of ZO1 and Occludin were performed with the StepOnePlus™ real-time PCR system and software (Applied Biosystems) using Mesa Fast qPCR™ (Eurogentec) for detection according to the manufacturer's instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were run in duplicate and data were analyzed according to the 2^−ΔCT method. The identity and purity of the amplified product was checked through analysis of the melting curve carried out at the end of amplification. Primer sequences for the targeted mouse genes are presented.

Brooks L., Viardot A., Tsakmaki A., Stolarczyk E., Howard J.K., Cani P.D., Everard A., Sleeth M.L., Psichas A., Anastasovskaj J., Bell J.D., Bell-Anderson K., Mackay C.R., Ghatei M.A., Bloom S.R., Frost G, & Bewick G.A. (2016). Fermentable carbohydrate stimulates FFAR2-dependent colonic PYY cell expansion to increase satiety. Molecular Metabolism, 6(1), 48-60.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega, Leiden, The Netherlands). Real-time PCR was performed with the StepOnePlus™ real-time PCR system and software (Applied Biosystems, Den Ijssel, The Netherlands) using Mesa Fast qPCR™ (Eurogentec, Seraing, Belgium) for detection according to the manufacturer’s instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^−ΔΔCT method. The identity and purity of the amplified product was assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table 4.

Everard A., Geurts L., Caesar R., Van Hul M., Matamoros S., Duparc T., Denis R.G., Cochez P., Pierard F., Castel J., Bindels L.B., Plovier H., Robine S., Muccioli G.G., Renauld J.C., Dumoutier L., Delzenne N.M., Luquet S., Bäckhed F, & Cani P.D. (2014). Intestinal epithelial MyD88 is a sensor switching host metabolism towards obesity according to nutritional status. Nature Communications, 5, 5648.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analyzing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent, Santa Clara, California, USA). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega, Madison, Wisconsin, USA). Real-time PCR was performed with the CFX96 real-time PCR system and CFX Manager 3.1 software (Bio-Rad, Hercules, California, USA) using Mesa Fast qPCR (Eurogentec, Liège, Belgium) for detection according to the manufacturer’s instructions. Rpl19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate, and data were analyzed according to the 2^−ΔΔCT method. The identity and purity of the amplified product were assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table 3.

Everard A., Plovier H., Rastelli M., Van Hul M., de Wouters d’Oplinter A., Geurts L., Druart C., Robine S., Delzenne N.M., Muccioli G.G., de Vos W.M., Luquet S., Flamand N., Di Marzo V, & Cani P.D. (2019). Intestinal epithelial N-acylphosphatidylethanolamine phospholipase D links dietary fat to metabolic adaptations in obesity and steatosis. Nature Communications, 10, 457.

+ Open protocol

+ Expand

RNA Extraction and Real-time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega, Leiden, The Netherlands). Real-time PCR was performed with the StepOnePlus™ real-time PCR system and software (Applied Biosystems, Den Ijssel, The Netherlands) using Mesa Fast qPCR™ (Eurogentec, Seraing, Belgium) for detection according to the manufacturer’s instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^-ΔCT method. The identity and purity of the amplified product was assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table S4.

Everard A., Lazarevic V., Gaïa N., Johansson M., Ståhlman M., Backhed F., Delzenne N.M., Schrenzel J., François P, & Cani P.D. (2014). Microbiome of prebiotic-treated mice reveals novel targets involved in host response during obesity. The ISME Journal, 8(10), 2116-2130.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega). Real-time PCR was performed with the StepOnePlus real-time PCR system and software (Applied Biosystems) using Mesa Fast qPCR (Eurogentec) for detection according to the manufacturer’s instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^−ΔΔCT method. The identity and purity of the amplified product were assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table 4.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche Diagnostics, Mannheim, Germany). Quantification and integrity analysis of total RNA were performed by analysing 1 μl of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit; Agilent, Waghaeusel-Wiesental, Belgium). cDNA was prepared by reverse transcription of 1 μg total RNA using a Reverse Transcription System kit (Promega, Leiden, The Netherlands). Real-time PCR was performed with the StepOnePlus real-time PCR system and software (Applied Biosystems, Den Ijssel, The Netherlands) using Mesa Fast qPCR (Eurogentec, Seraing, Belgium) for detection according to the manufacturer's instructions. RPL19 RNA was chosen as the housekeeping gene. All samples were performed in duplicate in a single 96-well reaction plate, and data were analysed according to the 2^−ΔCT method. The identity and purity of the amplified product was assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Supplementary Table S4.

+ Open protocol

+ Expand

Quantifying Yeast and Saccharomyces in Cecal Content

Check if the same lab product or an alternative is used in the 5 most similar protocols

Yeast cells were quantified using the primers YEASTF (5′ GAGTCGAGTTGTTTGGGAATGC 3′) and YEASTR (5′ TCTCTTTCCAAAGTTCTTTTCATCTTT 3′) following the method described by Hierro et al. (64 (link)). Saccharomyces was quantified using primers SC1 (5′ GAAAACTCCACAGTGTGTTG 3′) and SC2 (5′ GCTTAAGTGCGCGGTCTTG 3′) according to the method described by Zott et al. (65 (link)). Detection was achieved with the StepOnePlus real-time PCR system and software (Applied Biosystems) and Mesa Fast qPCR (Eurogentec) according to the manufacturer’s instructions. Each assay was performed in duplicate in the same run. The cycle threshold (C_T) of each sample was then compared with a standard curve (performed in triplicate) made by diluting genomic DNA (5-fold serial dilution) extracted from a pure culture of S. boulardii (Biocodex). The data are expressed as the log₁₀ of bacteria per g of cecal content.

Everard A., Matamoros S., Geurts L., Delzenne N.M, & Cani P.D. (2014). Saccharomyces boulardii Administration Changes Gut Microbiota and Reduces Hepatic Steatosis, Low-Grade Inflammation, and Fat Mass in Obese and Type 2 Diabetic db/db Mice. mBio, 5(3), e01011-14.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Mouse Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from tissues using TriPure reagent (Roche). Quantification and integrity analysis of total RNA were performed by analyzing 1 l of each sample in an Agilent 2100 Bioanalyzer (Agilent RNA 6000 Nano Kit, Agilent, Santa Clara, CA). cDNA was prepared by reverse transcription of 1 g total RNA using a reverse transcription system kit (Promega, Madison, WI). Real-time PCR was performed with the CFX96 real-time PCR system and CFX Manager 3.1 software (Bio-Rad, Hercules, CA) using Mesa Fast qPCR (Eurogentec, Liège, Belgium) for detection, according to the manufacturer's instructions. RPL19 was chosen as the housekeeping gene. All samples were performed in duplicate, and data were analyzed according to the 2 Ϫ⌬⌬CT method. The identity and purity of the amplified product were assessed by melting curve analysis at the end of amplification. The primer sequences for the targeted mouse genes are presented in Table 1.

Van Hul M., Geurts L., Plovier H., Druart C., Everard A., Ståhlman M., Rhimi M., Chira K., Teissedre P.L., Delzenne N.M., Maguin E., Guilbot A., Brochot A., Gérard P., Bäckhed F, & Cani P.D. (2018). Reduced obesity, diabetes, and steatosis upon cinnamon and grape pomace are associated with changes in gut microbiota and markers of gut barrier. American journal of physiology. Endocrinology and metabolism, 314(4).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!