Abi prism 3100 genetic analyzer

Total DNA was extracted from individual cerianthid specimen tentacles (Table 1) using InstaGene® (Bio-Rad #732-6030) or the DNAdvance® kit (Agencourt® #A48705). PCR reactions and conditions followed under predefined conditions ([13] (link); primers used in the present study are listed in Table 2). Amplicons were purified using AMPure® kit (Agencourt® #A63881) following manufacturer’s instructions, and made ready for sequencing using the BigDye® Terminator v3.1 kit (Applied Biosystems #4337455; same primers and Tm temperature conditions as in PCR reactions). Sequencing was carried out on an ABI PRISM®3100 genetic analyzer (Hitachi), and resulting sequences were assembled and edited using Geneious™ 5.4.4 (Table 1). Ceriantharia sequences from mitochondrial (COI, 16S) and nuclear (18S, 28S) molecular markers were obtained from 12 of the 50 taxonomically recognized species [28] .

The full length DNA sequences from the human ORs were amplified from human genomic DNA by PCR and subcloned into the pcDNA3.1(-) expression vector (Invitrogen). The OR sequences were also cloned with the 5′ addition of a Rho tag DNA sequence, as previously described (Von Dannecker et al., 2006 (link)). The sequences of the cloned ORs were checked by DNA sequencing on an ABI PRISM 3100 Genetic Analyzer (Hitachi, Japan). Primer sequences used for PCR amplification and cloning are:

Olfactory mucosa and liver were dissected from C57BL/6 or Olfr17tm7Mom/MomJ knock-in mice in PBS pH 7.4 and the genomic DNA was immediately purified using DNeasy Blood and Tissue Kit (Qiagen, Cat. No. 69504). DNA bisulfite conversion was performed using EpiTect Bisulfite Kits (Qiagen, Cat. No. 59104). The regions of interest were amplified by PCR using the bisulfite converted DNA and the following primers: Olfr17 promoter region (Forward TGTGTTATGATTGGTATTTTTG, Reverse CCATCCCATTATCTAATAAACTC); Olfr17 CDS 1 (Forward AGATGTTGAGTATTTTGATATT, Reverse ACATAAAAACCCAAAATCAAC); Olfr17 CDS 2 (Forward ATAGTTTTAGTTTGTGTTGATA, Reverse CAATATTTCCTTCAACATCCT).
The amplicons were synthetized by Platinum^® Taq DNA Polymerase (Invitrogen) and were subcloned using the Dual promoter TA cloning^® kit (Invitrogen, 45-0007LT). Individual clones were sequenced using BigDye^® Terminator v3.1 Cycle Sequencing Kit (Life Technologies^TM, Cat. No. 4337455) on an ABI PRISM 3100 Genetic Analyzer (Hitachi). The number of sequenced clones varied from 10 to 17 clones for the experiments with whole olfactory mucosa and from 12 to 25 clones per replica in the case of the dissociated cells (FACS experiments).