The PCR primers used for making hybridization probes are as follows: NHX165 FW, 5′ TGATTGGGCTAGGCACTG 3′; NHX7 RW, 5′ AAGATCAGGAGGGTTTCTCTC 3′; SOS1-842-FW, 5′ GGGCTTCTGGTGTTTTGACG 3′; SOS1-2881-RW, 5′ CGTTAGAAGGTGATAATGCGGC 3′; Act8-Forward, 5′ TCACCACAACAGCAGAGCGGG 3′; Act8-Reverse, 5′ GGACCTGCCTCATCATACTCGG 3′; 121southern-1F, GATTGAACAAGATGGATTGCACG; and 121southern-2R, CCCGATCATATTGTCGCTCAGG
Decaprime 2 dna labeling kit
The DECAprime II DNA Labeling Kit is a tool used for the random primed labeling of DNA. It provides a simple and efficient method for the generation of radiolabeled DNA probes for use in various applications, such as Southern blotting, Northern blotting, and dot blotting.
Lab products found in correlation
11 protocols using decaprime 2 dna labeling kit
Molecular Probes for Genetic Analysis
The PCR primers used for making hybridization probes are as follows: NHX165 FW, 5′ TGATTGGGCTAGGCACTG 3′; NHX7 RW, 5′ AAGATCAGGAGGGTTTCTCTC 3′; SOS1-842-FW, 5′ GGGCTTCTGGTGTTTTGACG 3′; SOS1-2881-RW, 5′ CGTTAGAAGGTGATAATGCGGC 3′; Act8-Forward, 5′ TCACCACAACAGCAGAGCGGG 3′; Act8-Reverse, 5′ GGACCTGCCTCATCATACTCGG 3′; 121southern-1F, GATTGAACAAGATGGATTGCACG; and 121southern-2R, CCCGATCATATTGTCGCTCAGG
Complementation of CRISPR Interference in H. volcanii
Quantitative analysis of RNA repression
To quantify the repression efficiency, Northern blotting membranes were exposed to imaging plates and analyzed with the Amersham Typhoon biomolecular imager and ImageQuantTL software. Signals were compared with the signals for the 16S rRNA used as a loading control. The amount of RNA signals detected for the wild-type controls was set to 100%. Northern blot analyses were done in triplicates.
Genomic DNA Preparation and Southern Blot Analysis
Design and Use of Gene-Specific Probes
Deletion of trpA Gene in HV31 Strain
RNA isolation and Northern blot analysis
Deletion of bgaH Gene in HV32 Strain
Cas6b Gene Deletion in HV29
Alkaline Gel Electrophoresis for DNA Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!