Point mutations were introduced into the pSV-PE WT plasmid encoding the structural proteins prM and E of the European subtype TBEV virus strain Neudoerfl (Gene bank accession number U27495) under the control of the SV40 promotor [23 (link)]. The mutations leading to W421A, W421H and W421L were introduced by site-directed mutagenesis (site-directed mutagenesis system from Invitrogen) following the manufacturer’s instructions (Life technologies). The primers (Eurofins Genomics, Ebersberg, Germany) used for site-directed mutagenesis are listed in Table 2 .
Site directed mutagenesis system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Site-Directed Mutagenesis System is a laboratory tool used to introduce specific modifications or mutations into DNA sequences. It allows for the precise alteration of genetic material, facilitating the study of gene function and structure.
Automatically generated - may contain errors
9 protocols using site directed mutagenesis system
1
Engineered TBEV Structural Protein Mutants
2
Generation of NL4-3 Mutant Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NL4-3 mutants (NL4-3YF9-1F) were previously generated by introducing the Nef YF9-1F mutation into NL4-3 using a site-directed mutagenesis system (Invitrogen, USA) [48 (link),49 (link)].
3
SORBS2 Mutation Analysis in AD-293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Because the human c.679+1G>T mutation is localized between intron 8 and intron 9 of the SORBS2 gene, a 2.4‐kb DNA fragment was cloned from the human SORBS2 gene (NM_021069) covering part of intron 9, whole exon 10, intron 10, exon 11, and part of intron 11. The amplified DNA fragment was cloned into an Nde I site of the pTBNde‐min vector (Addgene) to express a wide‐type SORBS2 fragment. To obtain the vector expressing a mutated SORBS2 fragment, mutagenesis was conducted using the site‐directed mutagenesis system (Invitrogen) with primer pairs 5′‐TCCTTATACATACAATGCAGTTAGGATGGGTTTCCTTGCTC‐3′ and 5′‐GAGCAAGGAAACCCATCCTAACTGCATTGTATGTATAAGGA‐3′. The vectors were transfected into AD‐293 cells. Forty‐eight hours later, RNA was extracted from the transfected cells to check alternative splicing via reverse transcription–PCR, with 5′‐CAACTTCAAGCTCCTAAGCCACTGC‐3′ as the forward primer and 5′‐TAGGATCCGGTCACCAGGAAGTTGGTTAAATCA‐3′ as the reverse primer.
4
Site-Directed Mutagenesis of AIFM2 3'-UTR Luciferase Reporter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Site-directed mutagenesis of the AIFM2 3’-UTR-luciferase reporter plasmid was accomplished according to the protocol from the Site-Directed Mutagenesis System (Thermo Fisher Scientific). The primers for mutagenesis are shown in Supplementary Table S5 . The miR-3622b-3p targeting motif sequences (868 to 875: UCAGGUGA) in the pMIR-AIFM2-3’-UTR construct were mutagenized to generate the targeting motif deletions.
5
Site-Directed Mutagenesis of EGLN3 3'-UTR Reporter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Site-directed mutagenesis of the EGLN3 3’-UTR-luciferase reporter plasmid was accomplished following the protocols from the Site-Directed Mutagenesis System (Thermo Fisher Scientific). The primers for mutagenesis are shown in Supplementary Table S2 . The miR-1205 targeting motif sequences (230 to 237: CCUGCAGA and 1162 to 1168: CCUGCAG after stop coding sequence) in the pMIR-EGLN3–3’UTR construct were mutagenized to generate the targeting motif deletions.
6
Characterizing NF-κB Regulation of CD274
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 2000-bp 5′-flanking region of the human CD274 gene containing a core promoter containing putative multiple NF-κB elements was cloned into the pGL3 vector (Promega, USA) to drive the luciferase reporter gene. Subsequently, a functional NF-κB binding site was mutated using a site-directed mutagenesis system (Thermo Fisher, USA). The luciferase reporter constructs were cotransfected with β-gal into PC-3 cells using Lipofectamine (Invitrogen). After 48 h, the luciferase activity was quantified by a luciferase assay system (Promega, USA) using a luminometer (Berthold Tech., Germany). The β-gal activity was quantified using microplate readers (BioTek, USA). NF-κB-mediated transcriptional enhancement was estimated by the β-gal-normalized luciferase response.
7
Site-Directed Mutagenesis of EGLN3 3'-UTR Reporter
8
Site-Directed Mutagenesis of AIFM2 3'-UTR Luciferase Reporter
9
Synthetic Yeast System for IAA17 Degradation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synthetic yeast system assay of IAA17 degradation dynamics was performed as previously described with minor modification (Havens et al., 2012; Chaisupa et al., 2023) (link). Yeast transformation was performed using a lithium acetate protocol (Gietz and Woods, 2002) . All the vectors were digested by PmeI enzyme to linearize prior to transformation. The vector pGP8G containing TIR1 was transformed into the W303-1A (MATα leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15) strain. The pGP4G vector, which contains a radiometric sensor Venus in-frame fused to IAA17, followed by a 2A self-cleaving peptide and mScarlet, was transformed into the W814-29B (MATα ade2-1 trp1-1 can1-100 ura3-1 leu2-3,112 his3-11,15) strain. Various mutations of IAA17 at Cys-70 to serine (S), tryptophan (W), phenylalanine (F), and tyrosine (Y) were created using Site-Directed Mutagenesis System (Thermo Fisher, SuperFi II). The empty vector pGP4G-Venus-mScarlet was used as a control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!