Bone marrow B cells from three WT or CGI-Eμ mice were stained with anti-B220 APC, anti-CD43 PE and anti-IgM FITC antibodies and individual B220+IgM−CD43high cells were FACS sorted using a BD FACS Aria Fusion machine directly into 96-well PCR plates containing 1× Colorless Go Taq buffer (Promega), 0.5 mg/ml proteinase K, 10 μg/ml tRNA and water. The plates were then incubated at 55°C for 1 h, at 95°C for 10 min, and subjected to qPCR using Sso Fast Eva Green. Each plate was used to amplify a single D–JH rearrangement.
Colorless go taq buffer
Manufactured by Promega
Sourced in United States
The Colorless Go Taq buffer is a buffer solution designed for use with the Go Taq DNA polymerase enzyme in polymerase chain reaction (PCR) applications. It provides the necessary chemical environment for the Go Taq enzyme to function effectively during DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using colorless go taq buffer
1
Isolation and Amplification of B Cell Receptor Rearrangements
2
Quantifying CLV2 Expression in NF5174 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine expression of CLV2 in the NF5174 line, synthesis of cDNA was performed using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) on 1 lg of DNase-treated RNA purified using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). PCR was performed using CLV2 primers (CATTTGGTTATTG-CATCGTTCA and ACGCGTTGGATATCTTGAGGA) and SECRET AGENT primers (GGCAGGTCTGCCTATGGTTA and GGTCAGACG CACAGATTTGA). Reactions (10 ml) contained 2 ml of cDNA (equivalent to 100 ng RNA), 1 mM each primer, 0.2 mM dNTPs, 1 9 colorless GoTaq buffer, and 1 U GoTaq (Promega, Madison, WI, USA) and were subjected to cycling conditions of 95°C for 2 min followed by 40 cycles of 95°C for 5 sec, 55°C for 10 sec, and 72°C for 20 sec.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!