The largest database of trusted experimental protocols

Ncode express sybr greener mirna qpcr kit

Manufactured by Thermo Fisher Scientific
Sourced in China, United States

The NCodeTM EXPRESS SYBR GreenERTM miRNA qPCR kit is a reagent used for the quantitative detection of microRNAs (miRNAs) in samples through real-time PCR. The kit contains SYBR GreenER, which is a fluorescent dye that binds to double-stranded DNA and emits a detectable signal during the amplification process, allowing for the quantification of miRNA targets.

Automatically generated - may contain errors

2 protocols using ncode express sybr greener mirna qpcr kit

1

Quantifying Differential Expression of Circulating RNAs in Osteoporosis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from BMSCs of OVX and control using miRcute miRNA isolation kit (TIANGEN, China, DP501), and 1 μg RNA from each sample was reverse-transcribed into cDNA using the NCodeTM EXPRESS SYBR GreenERTM miRNA qPCR kit (Invitrogen). The qPCR reaction was performed using the GeneAmp PCR system 9600 (Perkin Elmer). All specific primers are listed in Table 4, and were synthesized by Sangon Biotech (Sangon Biotech, Shanghai, China). Relative transcript levels of circRNAs and mRNAs were normalized with β-actin, while those of miRNAs were normalized with U6. The expression level of each mRNA, miRNA, and circRNA was calculated using comparative Ct method.

The probe sequences and primers for qRT-PCR in the experiment.

GenePrimer sequence
circRNA_3832F: CAATGACACTGGGACAGACG
R: GTTTGGGGTGAGTGTTTGCT
circRNA_0020F: CCTGAGAGATTTTAGTTCGAGGT
R: TTTGAACTGCGAGACACTGG
Runx3F: CAGGTTCAACGACCTTCGATT
R: GTGGTAGGTAGCCACTTGGG
NnmtF: AGCACAAGACGTGAGCGTAA
R: CGGATATCCAAAGGGGGCTC
Col3a1F: AAGGCTGCAAGATGGATGCT
R: GTGCTTACGTGGGACAGTCA
+ Open protocol
+ Expand
2

Quantitative PCR Analysis of lncRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Seven DElncRNAs were validated by qPCR. The cDNAs were reversed transcribed from RNA utilizing the NCodeTM EXPRESS SYBR® GreenERTM miRNA qPCR kit (Invitrogen, Carlsbad, CA, United States). We conducted qPCR reaction on the GeneAmp PCR system 9600 (Perkin Elmer, United States). All primers were obtained from Sangon Biotech (Shanghai, China), and their sequences are shown in Table 1. The relative lncRNAs expression was obtained after normalization to β-actin. 2–ΔΔCt method was applied to calculate the expression level of each lncRNA.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!