Sc 134362

Chromatin immunoprecipitation (ChIP) assay was performed using the EZ‐Magna ChIP kit (EMD Millipore). According to the manufacturer's procedure, NK cells were crosslinked with 4% paraformaldehyde (PFA) for 10 minutes and quenched with glycine. Next, cells were lysed with cell lysis buffer and nuclear lysis buffer and subjected to sonication to fragment chromatin to 200‐300 bp. Sonicated chromatin was then immunoprecipitated with magnetic protein A beads bound with antibodies, namely 2 μg negative control IgG (ab171870; Abcam), or 2 μg H3K27ac (ab203953; Abcam), 2 μg P300 (ab14984; Abcam), 2 μg H3K4me1 (ab8895; Abcam), and 2 μg CDX2 (sc‐134362; Santa Cruz Biotechnology Inc.). Finally, RT‐qPCR was applied to analyse the enrichment of proteins on the enhancer region of CXCL14 (chr5:134906373‐134914969). Primers used for qPCR included forward (5′‐3′): CACCTGCGAAGGAAGGAGTT and reverse (5′‐3′): TGAGGACTTCAGTGGGGTGA.

MCF-7 cells were fixed with formalin for 10 min to allow crosslinking of DNA and proteins. The ultrasonic breaker was set to 10 s per ultrasonic cycle with 10-s intervals with 15 cycles to break the chromatin. Then, the supernatant was harvested and divided into two tubes, one being supplemented with IgG (ab6785, Abcam) and the other added with target protein-specific antibodies to CDX2 (sc-134362, 2 µG/1 mL cell lysate, Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA) respectively. Next, the DNA–protein complex was precipitated using Protein Agarose/Sepharose, followed by de-crosslinking. DNA fragments were extracted and purified using a phenol/chloroform mixture. Finally, the binding of let-7b promoter region was detected using specific primers of the let-7b promoter.