Pierce ne per nuclear and cytoplasmic extraction reagent kit

An electrophoretic mobility shift assay was performed using the LightShift Chemiluminescent EMSA Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Nuclear extracts were prepared from H1299 and A549 cells using Pierce NE‐PER Nuclear and Cytoplasmic Extraction Reagent Kit (Thermo Fisher Scientific). Complementary 31‐bp oligonucleotides (based on rs2427964 from −15 to +15) were synthesized: 5′‐CTGAGCAGAAAGCTTCCAACCAAAATTAAAG‐ 3′ and 5′‐CTGAGCAGAAAGCTTTCAACCAAAATTAAAG‐3′ (the polymorphic alleles are indicated by bold letters). The DNA–protein complex bands were quantified by densitometry analysis using image‐studio 5.2 software (LI‐COR, Lincoln, NE, USA). A supershift assay was performed using 10 μg of nuclear extract incubated with SIN3A and ETS1 antibodies before the labeled probe step.

Whole-cell extracts were prepared in lysis buffer containing 2% SDS and 0.1 M Tris-HCl pH 6.8. Subcellular fractionation was performed using the Pierce™ NE-PER® Nuclear and Cytoplasmic Extraction Reagent Kit (ThermoFisher, #78833). Protein concentration was determined using the Pierce™ BCA Protein Assay Kit (Thermo Scientific) and measuring absorbance at 560 nm with the Biosan HiPo MPP-96 microplate photometer. Equal amounts of protein were run in Mini-PROTEAN TGX gels (Bio-Rad #4568124) followed by western blotting. Primary antibodies used were as follows: SMAD3 (Abcam, ab208182, 1:1000), PITX1 (ThermoFisher, A300-577A-T, 1:1000), TNIK (Abcam, ab224252, 1:1000), EPHB3 (Abcam, ab133742, 1:1000), Histone H3 (Abcam, ab176842) and GAPDH (Cell Signaling, #14C10). Peroxidase AffiniPure secondary antibodies (Jackson ImmunoResearch, 111-035-003, 1:10,000) and ECL substrate were used for signal detection. Target protein expression was normalised to the stain-free total protein measurement using the Image Lab™ Software (Bio-Rad). Uncropped blots are displayed in Supplementary Fig. 14.