Log In Sign up
The largest database of trusted experimental protocols

Direct zol rna mini kit

Manufactured by Zymo Research
Visit Supplier
Sourced in United States

The Direct-zol RNA Mini Kit is a laboratory product designed for the isolation and purification of total RNA from various biological samples, including cells, tissues, and biofluids. The kit utilizes a proprietary technology to directly extract RNA without the need for separate lysis and extraction steps, allowing for a streamlined and efficient RNA isolation process.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (8 mentions) Nanodrop 1000, by Thermo Fisher Scientific (6 mentions) Bullet blender, by Next Advance (3 mentions) Perfecta sybr green supermix, by Quanta Biosciences (2 mentions) M mlv reverse transcriptase, by Takara Bio (2 mentions) Rna stat 60 rna isolation reagent, by AMS Biotechnology (2 mentions) Cfx384 real time system, by Bio-Rad (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Nanodrop system, by Thermo Fisher Scientific (2 mentions) Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions) Hiseq 3000 4000, by Illumina (1 mentions) Plightswitch 5utr, by SwitchGear Genomics (1 mentions) Lipofectamine, by Thermo Fisher Scientific (1 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions) Rna clean and concentrator column, by Zymo Research (1 mentions) Dnase, by Qiagen (1 mentions) Taqman fast virus 1 step master mix, by Thermo Fisher Scientific (1 mentions) Maxwell 16, by Promega (1 mentions) Lev simplyrna tissue kit, by Promega (1 mentions) Abi 7500 fast, by Roche (1 mentions)

23 protocols using direct zol rna mini kit

1

SARS-CoV-2 RNA Detection in Murine Samples

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Equal volumes of BAL from each mouse was mixed with Trizol (Thermo Fisher). RNA was extracted using Direct Zol RNA mini kit (Zymo Research), and analyzed for the content of SARS-CoV-2 RNA by RT-qPCR using the following primers/probes as previously described [47] (link). SARS-CoV-2 E gene: forward: ACAGGTACGTTAATAGTTAATAGCGT; reverse: ATATTGCAGCAGTACGCACACA; probe: FAM- ACACTAGCCATCCTTACTGCGCTTCG-MGB.
Lung tissue was lysed in Trizol and RNA was extracted using Direct Zol RNA mini kit (Zymo research). The copy number of SARS-CoV-2 RNA was determined by analysing 5 ng of RNA from each lung tissue sample, using E gene RNA transcripts of a defined copy number (EDX SARS-CoV-2 Standard, Biorad) to generate a standard curve. Primers and probes as above.
Elder E., Bangalore Revanna C., Johansson C., Wallin R.P., Sjödahl J., Winqvist O, & Mirazimi A. (2023). Protective immunity induced by an inhaled SARS-CoV-2 subunit vaccine. Vaccine.
+ Open protocol
+ Expand
2

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For tissue RNA extraction, tissues were harvested into RNA STAT-60 RNA isolation reagent (Amsbio) and disrupted by bead homogenization (Omni, INC). RNA was extracted using the Direct-zol RNA Mini Kit (Zymo, R2051). cDNA synthesis was performed using MMLV reverse transcriptase (Clontech) with oligo(dT) primers. qRT PCR was performed on CFX384 Real-Time System (Bio-Rad) using PerfeCTa SYBR Green Supermix (Quanta Biosciences) and transcripts were normalized to Rpl13a.
Florsheim E.B., Bachtel N.D., Cullen J., Lima B.G., Godazgar M., Zhang C., Carvalho F., Gautier G., Launay P., Wang A., Dietrich M.O, & Medzhitov R. (2023). Immune sensing of food allergens promotes aversive behaviour. bioRxiv.
+ Open protocol
+ Expand
3

RNA-seq Library Preparation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells by using TRIzol (Invitrogen) and purified by using Direct-zol RNA mini kit (Zymo Research) with DNase I treatment. After RNA purification, samples were confirmed to have a RIN value > 9.0 when measured on an Agilent Bioanalyzer. Libraries for RNA sequencing were prepared with KAPA Stranded RNA-Sequencing Kit. Briefly, the workflow consisted of mRNA enrichment, cDNA synthesis, end repair to generate blunt ends, A-tailing, adapter ligation, and 14 cycles of PCR amplification. Unique adapters were used for each sample in order to multiplex samples into several lanes. Sequencing was performed on Illumina Hiseq 3000/4000 with a 150-bp pair-end run by Quick Biology (Pasadena, CA).
Godet I., Shin Y.J., Ju J.A., Ye I.C., Wang G, & Gilkes D.M. (2019). Fate-mapping post-hypoxic tumor cells reveals a ROS-resistant phenotype that promotes metastasis. Nature Communications, 10, 4862.
+ Open protocol
+ Expand
4

Differential Translational Regulation of Non-Coding Exons

Check if the same lab product or an alternative is used in the 5 most similar protocols
To establish whether the non-coding exons of the isoforms expressed in the dorsal skin of Peromyscus showed differences in translation, we generated luciferase reporter plasmids by cloning each of the three noncoding exons (1C, 1D, or 1E) from both P. maniculatus wideband and wild-type strains into a 5' UTR reporter vector (pLightSwitch_5UTR; Switchgear Genomics) upstream of the luciferase coding sequence and downstream of the ACTB promoter. We generated mutated 1D reporter plasmids from the wild-type 1D plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). We transfected plasmids into HEK293 cells using Lipofectamine (Invitrogen), with six replicate transfections per construct. Forty-eight hours after transfection, we measured luminescence as a readout of protein production using a microplate reader (SpectraMax L). We quantified transcription from each plasmid as follows: we collected six replicates of transfected cells in TRIzol reagent (Invitrogen) and extracted RNA using the Direct-zol RNA Mini Kit (Zymo Research). We then carried out qPCR as described above using the primer pairs Luciferase-F and -R, and β-actin-Human-F and -R. Primer sequences can be found in Supplementary Table 1.
Mallarino R., Linden T.A., Linnen C.R, & Hoekstra H.E. (2017). The role of isoforms in the evolution of cryptic coloration in Peromyscus mice. Molecular ecology, 26(1).
+ Open protocol
+ Expand
5

Sorting and Isolating Mucosal-Associated Invariant T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were surface stained using the flow cytometry staining protocol above. Specifically, cells were stained with propidium iodide viability stain, MR1/5-OP-RU tetramer, and antibodies to CD45, CD4, CD8. Lung samples were also stained with antibodies to CD20, CD14, and EpCAM for removal of B cells, myeloid cells, and epithelial cells. Live, CD45 + , CD4 negative, CD14/CD20/EpCAM negative were sorted into four populations: MR1/5-OP-RU + CD8+, MR1/5- OP-RU + CD8 negative, MR1/5-OP-RU-negative CD8+, and MR1/5-OP-RU-negative CD8 negative. Cells were sorted into TRIzol (Thermo-Fisher) and RNA was isolated using a Direct-zol RNA-mini kit with RNA clean and concentrator columns (Zymo Research) and treated with DNase (Qiagen).
Meermeier E.W., Zheng C.L., Tran J.G., Soma S., Worley A.H., Weiss D.I., Modlin R.L., Swarbrick G., Karamooz E., Khuzwayo S., Wong E.B., Gold M.C, & Lewinsohn D.M. (2022). Human lung-resident mucosal-associated invariant T cells are abundant, express antimicrobial proteins, and are cytokine responsive. Communications Biology, 5, 942.
+ Open protocol
+ Expand
6

ZIKV Intracellular RNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated following the manufacturer’s instructions while using DirectZOL RNA mini kit (Zymo Research, Murphy Ave, Irvine, CA, USA). One-step qRT PCR was performed using TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). For intracellular ZIKV RNA levels, normalization was performed to hbActin expression in uninfected, DMSO treated samples while using ΔΔCT Method. For supernatants, the obtained Ct values were converted to the number of ZIKV RNA molecules using a standard curve that was created using Quantitative Synthetic ZIKV RNA from ATCC (ATCC® VR-3252SD™). Details of the primers used can be found in Table S1.
Pettke A., Tampere M., Pronk R., Wallner O., Falk A., Warpman Berglund U., Helleday T., Mirazimi A, & Puumalainen M.R. (2020). Broadly Active Antiviral Compounds Disturb Zika Virus Progeny Release Rescuing Virus-Induced Toxicity in Brain Organoids. Viruses, 13(1), 37.
+ Open protocol
+ Expand
7

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using the Promega Maxwell 16 with the LEV simplyRNA tissue kit (Promega AS1270), the Roche MagNAPure with the Cellular Total RNA Large Volume kit (Roche 05467535001), or the DirectZol RNA Mini kit (Zymo R2051). cDNA was prepared using dNTPs (Thermo Fisher R0181), random hexamers (Jena Bioscience PM-301) and M-MuLV reverse transcriptase (NEB M0253). For quantitative RT–PCR, specific Taqman probes and primers (Thermo Fisher 4331182) were used with TaqMan Universal PCR Master Mix (Applied Biosystems 4305719) or LightCycler© 480 Probes Master (Roche 04887301001). PCRs were performed on the Applied Biosystems ABI 7500 Fast or the Roche LightCycler 480 in technical triplicates.
Pott F., Postmus D., Brown R.J., Wyler E., Neumann E., Landthaler M, & Goffinet C. (2021). Single-cell analysis of arthritogenic alphavirus-infected human synovial fibroblasts links low abundance of viral RNA to induction of innate immunity and arthralgia-associated gene expression. Emerging Microbes & Infections, 10(1), 2151-2168.
+ Open protocol
+ Expand
8

RNA Extraction and Quantitative PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
For tissue RNA extraction, tissues were collected into RNA STAT-60 RNA isolation reagent (Amsbio) and disrupted by bead homogenization (Omni, INC). RNA was extracted using the Direct-zol RNA Mini Kit (Zymo, R2051). cDNA synthesis was carried out using MMLV reverse transcriptase (Clontech) with oligo(dT) primers. Quantitative PCR with reverse transcription was carried out on the CFX384 Real-Time System (Bio-Rad) using PerfeCTa SYBR Green Supermix (Quanta Biosciences) and transcripts were normalized to Rpl13a.
Florsheim E.B., Bachtel N.D., Cullen J.L., Lima B.G., Godazgar M., Carvalho F., Chatain C.P., Zimmer M.R., Zhang C., Gautier G., Launay P., Wang A., Dietrich M.O, & Medzhitov R. (2023). Immune sensing of food allergens promotes avoidance behaviour. Nature, 620(7974), 643-650.
+ Open protocol
+ Expand
9

Wound Healing Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Biopsies (4 mm) were also taken from each wound on days 5, 7, and 10 post-treatment for gene expression analyses associated with the wound healing process and host inflammatory response. RNA was isolated using Direct-zol RNA Mini Kit (Zymo Research, CA, United States) per company protocol. Real-Time PCR (qPCR) was performed using a One-Step RT-PCR Kit (Quanta) and run on a CFX96 Real-Time PCR System (Bio-Rad, CA, United States) to detect expression levels of the following genes: interleukin-1α (IL-1α), interleukin-8 (IL-8) and tumor necrosis factor α (TNF-α). Relative expression was normalized to housekeeping gene GAPDH. Primer sequences used were: GAPDH, forward GAPDH, forward (5′-ACATCATCCCTGCTTCTAC-3′) and reverse (5′-TTGCTTCACCACCTTCTTG-3′); IL-1α, forward (5′-GCCAATGACACAGAAGAAG-3′) and reverse (5′-TCCAGGTTATTTAGCACAGC-3′); IL-8, forward (5′-GAC CAGAGCCAGGAAGAGAC-3′) and reverse (5′-GGTGG AAAGGTGTGGAATGC-3′); TNF-α forward (5′-CACGCTCTT CTGCCTACTG-3′) and reverse (5′-ACGATGATCTGAGT CCTTGG -3′).
Gil J., Pastar I., Houghten R.A., Padhee S., Higa A., Solis M., Valdez J., Head C.R., Michaels H., Lenhart B., Simms C., Williams B., Cudic P, & Davis S.C. (2021). Novel Cyclic Lipopeptides Fusaricidin Analogs for Treating Wound Infections. Frontiers in Microbiology, 12, 708904.
+ Open protocol
+ Expand
10

Quantitative PCR Analysis of Hippocampal RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from 4 replicate wells of hippocampal cells in a 12-well plate using Trizol, followed by phase separation using chloroform. The aqueous layer of the phase separation was applied to the column of the Direct-Zol RNA Mini Kit (Zymo; Irvine, CA; Cat #: ZR2070), and isolated following manufacturer’s protocol. RNA concentrations were determined using a Nanodrop spectrophotometer, and 0.5 μg total RNA was reverse transcribed into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad; #1708891). Real-time quantitative polymerase chain reactions (RT-qPCR) were performed in 10 μl reactions containing Power SYBER Green PCR master mix (Bio-Rad; Cat #: 172–5121), 5 ng of cDNA, and 500 nM of the specific forward and reverse primers. RT-qPCR was performed on a CFX96 RT-qPCR system (Bio-Rad) using the following conditions: a 3 min initial denaturation at 95°C, followed by 39 cycles of 15s denaturation at 95°C, 15s annealing at 60°C, and 30s extension at 72°C. Primers used during this experiment included: GAPDH: forward: 5’-CGTGTTCCTACCCCCAAT-3’ reverse: 5’-TGTCATCATACTTGGCAGGTTTCT-3’; proSAAS: forward: 5’-GTC GGC ATT TTG GTG CTG-3’ reverse: 5’-ATT GAG GGC TCA GGG GAT-3’; and CPE: forward: 5’-TGA GAA AGA AGG CGG TCC TAA C-3’ reverse 5’-GCA GAT TGG CAG AAA GCA CAA-3’.
Mitias S., Schaffer N., Nair S., Hook C, & Lindberg I. (2024). ProSAAS is Preferentially Secreted from Neurons During Homeostatic Scaling and Reduces Amyloid Plaque Size in the 5xFAD Mouse Hippocampus. bioRxiv.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!