For generating stable cell lines, lentiviruses (System Biosciences, San Francisco, CA, USA) harboring scrambled shRNA (shNC) or specific shRNAs against signal transducer and activator of transcription 2 (shSTAT2) were transduced into chemoresistant ovarian cancer organoids and OVCA433 cells. The sequences of shSTAT2 were as follows: 5’‐CCACAUAGCUGAUCUGAAAUU‐3’. lentiviruses were generated by HEK293T cells with recombinant vectors and pPACK Packaging Plasmid Mix (System Biosciences). shRNA vectors were produced by cloning short hairpin RNA fragments into pSIH‐H1‐Puro (SBI) and overexpression vectors were generated by inserting amplified gene fragments into pCDH (System Biosciences).
Lentivirus
Manufactured by System Biosciences
Sourced in United States
Lentivirus is a type of viral vector used for gene delivery in biological research. It is capable of integrating the gene of interest into the host cell genome, enabling long-term expression of the target gene. The core function of lentivirus is to facilitate the efficient and stable transduction of genetic material into a wide range of cell types, including non-dividing cells.
Automatically generated - may contain errors
Lab products found in correlation
Polybrene, by Merck Group (2 mentions)
Ppack packaging plasmid mix, by System Biosciences (1 mentions)
Puromycin, by Merck Group (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Lsrfortessa, by BD (1 mentions)
Lenti x htx packaging system, by Takara Bio (1 mentions)
Lentivirus, by Merck Group (1 mentions)
Evos fluorescence microscope, by Thermo Fisher Scientific (1 mentions)
Nucleofector kit, by Lonza (1 mentions)
Pre mir mirna precursor, by Thermo Fisher Scientific (1 mentions)
Siport neofx transfection reagent, by Thermo Fisher Scientific (1 mentions)
Pkc412, by Merck Group (1 mentions)
Pbabe puro vector, by Addgene (1 mentions)
Dnase 1, by Merck Group (1 mentions)
Penicillin and streptomycin, by Thermo Fisher Scientific (1 mentions)
Hela cell, by American Type Culture Collection (1 mentions)
Hek293t cell, by American Type Culture Collection (1 mentions)
Fetal bovine serum (fbs), by Sartorius (1 mentions)
Mg132, by Merck Group (1 mentions)
Anti flag m2 affinity gel, by Merck Group (1 mentions)
8 protocols using lentivirus
1
Generation of Stable Ovarian Cancer Cell Lines
2
Establishing LINK-A-knockdown NSCLC Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain a stable LINK-A-knockdown cell line, a lentivirus carrying LINK-A-shRNA (System Biosciences, Palo Alto, CA, USA) was infected into A549 cells using polybrene (4 μg/mL, Sigma-Aldrich Co., St Louis, MO, USA). At 48 hours post viral infection, the medium was changed to Roswell Park Memorial Institue-1640 containing 10% fetal bovine serum, followed by selection with 1 μg/mL of puromycin (Sigma) for 14 days. The shRNA targeting LINK-A sequence was 5′-TGTCTAAGGTGGAGATTAC-3′. The target sequence for HKII was 5′-CGGACAGAACACGGAGAGdTdT-3′ (Thermo Fisher Scientific). The siRNA was transfected into NSCLC cells separately using Lipofectamine 2000 reagent (Thermo Fisher Scientific) in accordance with the manufacturer’s instructions.
3
Nanog Promoter-Driven RFP Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus, encoding the mouse Nanog promoter driving RFP expression, was purchased from System Biosciences (SR10044VA-1). EL16.7 TST X-GFP MKOS ESCs were infected at an MOI of 30 and RFP-positive cells FACS purified using a BD Influx. Single clones were isolated and selected based on proper RFP expression using FACS analysis on a BD LSRFortessa.
4
Lentivirus-Mediated miR-139-5p Overexpression in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miR-139-5p overexpression in HUVECs, a lentivirus bearing miR-139-5p was obtained from System Biosciences. The Lenti-X HTX packaging system (Clontech, Mountain View, USA) with Lenti-X concentrator was used to generate the lentivirus particles for in vitro cellular transduction.
5
Lentiviral Transduction of Prostate Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ultrahigh titre of lentivirus from CD511B-1 + miR-183FC and CD511B-1 scrambled control was produced by Systems Biosciences (Mountain View, CA) and used to transduce RWPE-1, RWPE-2, and PrE cells by spinfection45 (link) via UIC Institutional Biosafety Committee approved protocol (#15–020). Briefly, lentivirus (120 MOI) and polybrene (8 μg/ml) (Sigma Aldrich St. Louis, MO) were added to 75,000 cells in a polystyrene tube, incubated 1hr 37 °C, centrifuged at 750 × g 25 °C for 1hr and re-plated. GFP expression was evident at 72hr using EVOS fluorescence microscope (ThermoScientific). PC-3 with knockdown of the miR-183 family were generated using the miRZIP Lentivector-based Anti-miR system (System Biosciences, Palo Alto, CA), with shRNA targeted to miR-183 or control scrambled shRNA, and maintained under selection with 1.5 μg/ml puromycin.
6
Inducible GFP-tagged ER Expression in PRL-HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PRL-HeLa cells expressing tetracycline-inducible full length GFP-tagged ERα was generated by cloning the EGFP-C1-ER or the EGFP-N1-ER coding region into pINDUCER20, containing a tetracycline-inducible promoter, a gift from Dr. Trey Westbrook (Baylor College of Medicine, Houston, TX). Despite the large packaging size of the vectors, high titer Lentivirus was generated by System Biosciences LLC (Palo Alto, CA). In a parallel process, PRL-HeLa cells were transduced with either inducible GFP-ER (iGFP-ER) or inducible ER-GFP (iER-GFP) viral particles and cells with a stable integration were enriched using geneticin (G418) drug selection, flow cytometry, and single cell cloning. The final populations of iGFP-ER:PRL-HeLa and iER-GFP:PRL-HeLa cells are >95% GFP positive following doxycycline induction. Both cell lines are maintained in phenol red-free Dulbecco’s modified Eagle’s medium (DMEM-HG) supplemented with 5% FBS, 200 μg/ml hygromycin, and 400 μg/ml G418.
For experiments, iGFP-ER and iER-GFP PRL-HeLa cells were seeded in phenol red-free DMEM with 5% charcoal-stripped/dialyzed FBS without selection agents or inhibitors on 384-well plates (384-IQ, Aurora Biotechnologies) at a target density of 3,000 cells/well. Cells were left to adhere overnight. Cell lines, cells were treated with doxycycline (0.8 μg/ml) for 20 hours before media was exchanged prior to treatment
For experiments, iGFP-ER and iER-GFP PRL-HeLa cells were seeded in phenol red-free DMEM with 5% charcoal-stripped/dialyzed FBS without selection agents or inhibitors on 384-well plates (384-IQ, Aurora Biotechnologies) at a target density of 3,000 cells/well. Cells were left to adhere overnight. Cell lines, cells were treated with doxycycline (0.8 μg/ml) for 20 hours before media was exchanged prior to treatment
7
Lentiviral Transduction of PRMT5 and miR-29b
8
KSHV Latency and Reactivation Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
iSLK.RGB cells, which harbor wild-type BAC16.RGB were a kind gift from Jae Jung (University of Southern California, Los Angeles, USA) and were cultured in Dulbecco’s modified Eagle’s medium (DMEM, HyClone). The primary effusion lymphoma cell line BCBL1, which carries latently infected KSHV, was cultured in RPMI 1640 medium (HyClone). Human embryonic kidney 293T cells (HEK293T cells) and the Henrietta Lacks strain of cancer cells (HeLa cells) were purchased from the American Type Culture Collection (ATCC) and cultured in DMEM. The stable cell lines iSLK.RGB-Vector, iSLK.RGB-RAB11FIP5, HeLa-Vector and HeLa-RAB11FIP5 were established by infection with the indicated lentiviruses in accordance with the manufacturer’s instructions (System Bioscience, Palo Alto, USA). All cultures were supplemented with 10% FBS (Biological Industries) and 1% antibiotic solution (penicillin and streptomycin, Gibco) and grown at 37°C in a humidified environment supplemented with 5% CO2.
Dox, VPA and DNase I were purchased from Sigma-Aldrich (St. Louis, MO), as was an anti-Flag M2 affinity gel (Sigma-Aldrich, A2220). The proteasome inhibitor MG132 (474790) was purchased from Merck Millipore. The lysosomal inhibitor CHLO (C6628) was purchased from Sigma-Aldrich.
Dox, VPA and DNase I were purchased from Sigma-Aldrich (St. Louis, MO), as was an anti-Flag M2 affinity gel (Sigma-Aldrich, A2220). The proteasome inhibitor MG132 (474790) was purchased from Merck Millipore. The lysosomal inhibitor CHLO (C6628) was purchased from Sigma-Aldrich.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!