All animals used in this study were housed at the University of Pittsburgh Division of Laboratory Animal Resources, Rangos Research Building, following the IACUC protocol number 2206137, which was approved by the University of Pittsburgh’s Institutional Animal Care and Use Committee. The colony of mutant mice was established by breeding female heterozygous Sms mutation carriers (C57BL/6J-Smsem2Lutzy/J; Jackson Laboratory stock # 031170) and male WT C57BL/6J mice (Jackson Laboratory stock # 000664). The male offspring of this cross that harbored the X-linked G56S Sms mutation and WT littermate controls were used in the experiments described in this study. To ensure that only male mice harboring the desired mutation were used, pups were genotyped at Transnetyx.com using the following probes: forward primer ACCTGGCAGGACCATGGATATTTA, reverse primer GTGTTCACATCTAAAGCCCATGAGA, reporter 1 AACAAGAATGGCAGGTAAG and reporter 2 ACGAACAAGAATTCCAGG.
C57bl 6j smsem2lutzy j
Manufactured by Jackson ImmunoResearch
The C57BL/6J-Smsem2Lutzy/J is a mouse strain developed for research purposes. This strain carries a spontaneous mutation in the Sms gene, which is involved in the biosynthesis of the polyamine spermidine. The phenotypic characteristics of this strain may be of interest to researchers studying spermidine metabolism or related biological processes.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using c57bl 6j smsem2lutzy j
1
Genotyping Protocol for X-linked Sms Mutation
2
Establishing a Mutant Mouse Colony
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animals used in this study were housed at the University of Pittsburgh Division of Laboratory Animal Resources, Rangos Research Building, which was approved by the University of Pittsburgh's Institutional Animal Care and Use Committee (protocol number 2206137). The colony of mutant mice was established by breeding female heterozygous Sms mutation carriers (C57BL/6J-Smsem2Lutzy/J; The Jackson Laboratory, 031170) and male wild-type C57BL/6J mice (The Jackson Laboratory, 000664). The male offspring of this cross that harbored the X-linked G56S Sms mutation and wild-type littermate controls were used in the experiments described in this study. To ensure that only male mice harboring the desired mutation were used, pups were genotyped at Transnetyx using the following probes: forward primer, 5ʹ-ACCTGGCAGGACCATGGATATTTA-3ʹ; reverse primer, 5ʹ-GTGTTCACATCTAAAGCCCATGAGA-3ʹ; reporter 1, 5ʹ-AACAAGAATGGCAGGTAAG-3ʹ; and reporter 2, 5ʹ-ACGAACAAGAATTCCAGG-3ʹ.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!