Gel green

This study was approved by the Ethics Committee of Peking Union Medical College Hospital. C57BL/6J mice were obtained from the Vital River Laboratory Animal Technology (Beijing, China). Lrp5^fl/fl conditional-ready mice and Prrx1-cre transgenic mice were purchased from the Shanghai Model Organisms Center (Shanghai, China). To generate Lrp5 CKO mice, Lrp5^fl/fl mice were crossed with Prrx1-cre mice to get Lrp5^fl/fl; Prrx1-cre genotype. Mouse genome DNA was extracted from tail of mice at postnatal day 10 (P10), and the amplification of target genes (Lrp5 and Prrx1-cre) was done following a described protocol (Truett et al., 2000 (link); Cui et al., 2011 (link)). A 2.5% Agarose-TAE gel containing Gel-Green (D0143, Beyotime, Beijing, China) was used for electrophoresis of PCR products.

The prevalence of the exoU gene in different clinical isolates was determined by PCR. Briefly, exoU was amplified with primers (exoU-F: ATGCATATCCAATCGTTGGG, exoU-R: TCATGTGAACTCCTTATTCCGC). PCR was carried out as follows: 2-µL template genomic DNA (50–100 ng), 10 µM of each primer, 12.5 µL of 2 × Phanta Flash Master Mix (Vazyme), added ddH₂O to a final volume of 25 µL. The DNA was amplified using the following protocol: 98°C for 30 s, then 30 cycles at 98°C for 10 s, Tm for 5 s and 72°C for 15 s, then a final extension at 72°C for 1 min. PCR products were separated in 1% agarose gel for 30 min at 120 V, stained with Gel-Green (Beyotime, China) and detected by iBright CL750 Imaging System (Thermo Fisher Scientific).

Neutral comet assays were performed to determine the level of DSB. First, a 0.8% normal melting-point agarose (YEASON) layer was prepared on frosted slides. Second, 30 μL of cell suspension (1.5 × 10⁶ cells/mL) was mixed with 80 μL of 1.5% low melting-point agarose (AMRESCO) and the mix was layered onto the precoated slides to form a cell-embedded agarose layer. The lysis was performed at 4 °C for 2 h. The lysed slides were subsequently soaked in TBE buffer for 30 min, and then electrophoresed in TBE for 20 min at 25 V, 15 mA. Finally, the slides were stained with Gel-Green (Beyotime, Shanghai, China), and images of more than 50 cells were acquired with a Leica DMi3000 B fluorescence microscope and analyzed by the OpenComet [45 (link)] plugin in ImageJ (National Institutes of Health).