The largest database of trusted experimental protocols

Rna total cleanup kits

Manufactured by Qiagen

The RNA total cleanup kits from Qiagen are designed to purify total RNA from various sample types. They utilize a silica-membrane technology to efficiently capture and wash RNA, removing contaminants and inhibitors. The kits provide a convenient and reliable method for obtaining high-quality RNA suitable for downstream applications such as RT-qPCR, RNA sequencing, and other RNA-based analyses.

Automatically generated - may contain errors

Lab products found in correlation

2 protocols using rna total cleanup kits

1

Quantitative qPCR Analysis of Immune Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA isolated from given samples was purified using the QIAGEN RNA total cleanup kits as per manufacturers instruction. One hundred nanogram of the RNA was converted using EvaGreen RT conversion kit in a gradient thermocycler as per manufacturers description (ABMbio, USA). One nanogram of the converted cDNA samples was added to Bright-Green SYBR qPCR master-mix and qPCR analysis was performed in an ABI StepOne Plus PCR system. The PCR conditions were as follows: 95 °C for 1 min followed by 40 cycles at 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s, and with a final round of extension at 72 °C for 10 min15 (link). Sequences of primers used are detailed in Table 1.

qPCR genes of interest, sense and antisense primer sequence and amplicon size.

GeneForward primer 5′-3’Reverse primer 5′-3’SizeRefs.
CXCL10GAAAGCAGTTAGCAAGGAAAGGTCATGTAGGGAAGTGATGGGAGAGG12016 (link)
CCR7TGGTGGTGGCTCTCCTTGTCTGTGGTGTTGTCTCCGATGTAATC8316 (link)
IL-12AAAGGACATCTGCGAGGAAAGTTCCGAGGTGAGGTGCGTTTATGC12816 (link)
CD206ACCTCACAAGTATCCACACCATCCTTTCATCACCACACAATCCTC21316 (link)
CD163GTCGCTCATCCCGTCAGTCATCGCCGCTGTCTCTGTCTTCGC11416 (link)
CCL17GAGCCATTCCCCTTAGAAAGAGGCTTCAAGACCTCTCAAG17216 (link)
NFκB (RELA)CCAGACCAACAACAACCCCTTCACTCGGCAGATCTTGAGC19717 (link),18 (link)
IRF3TCTGCCCTCAACCGCAAAGAAGTACTGCCTCCACCATTGGTGTC15117 (link)
+ Open protocol
+ Expand
2

RNA Purification and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA isolated from given samples was purified using the QIAGEN RNA total cleanup kits as per manufacturers instruction. One hundred nanogram of the RNA was converted using EvaGreen RT conversion kit in a gradient thermocycler as per manufacturers description. One nanogram per microliter of the converted cDNA samples was added to EvaGreen SYBR qPCR master-mix and qPCR analysis was performed in an ABI StepOne Plus PCR system. Annealing temperatures were kept at 60°C, and 40 cycles of amplification were performed to produce a sufficient read. Sequences of primers used are detailed in Table 2.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!