Sybr green master mix

Total RNA of colonic tissue was extracted by using Trizol reagent. The purity and concentration of RNA were measured by spectrophotometer, and they were reverse transcribed using a complementary DNA (cDNA) conversion kit (Thermo Fisher Scientific, USA). Real-time PCR was carried out by SYBR Green master mix (Beijing ComWin Biotech Co., Ltd., China) in the 7900HT Fast Real-Time PCR system. GAPDH was used as the standard control. Primer sequences are listed in Table 1.
Table 1

The primers used in qRT-PCR

Primers	Forward	Reverse
IL-1b	TGCCACCTTTTGACAGTGATC	AAGGTCCACGGGAAAGACAC
TNF-α	TGACTCCAAAGTAGACCTGC	CTACTCCCAGGTTCTCTTCA
Cxcl9	AACGGAGATCAAACCTGCCT	AGATTCAGGGTGCTTGTTGGT
Mmp9	CGACTTTTGTGGTCTTCCCC	CTTCTCTCCCATCATCTGGGC
Muc16	GCTCAGCACATCGACACAGA	CTCGTGCCTTTCATAGCAGC
Ereg	ACATGGACGGCTACTGCTTG	AAGTGCTCACATCGCAGACC
Gapdh	GCAGAGTGTTTCCTCGTCCC	ACTGTGCCGTTGAATTTGCC

Total RNA was extracted using TRIzol reagent (CoWin Biosciences, Beijng, China) and transcribed into cDNA with a Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, USA), according to the manufactures’ instructions. Then, real-time quantitative PCR (RT-qPCR) was performed using SYBR Green Master Mix (CoWin Biosciences, Beijng, China). The reaction conditions were: pre-denaturation at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 30 s. The level of GAPDH cDNA (F: 5′-CCTCGTCCCGTAGACAAAATG-3′, R: 5′-TGAGGTCAATGAAGGGGTCGT-3′) was used as internal reference to quantify the level of SIRT-1 (F: 5′-TTCAGAACCACCAAAGCGGA-3′, R: 5′-TCCCACAGGAGACAGAAACCC-3′) and PGC-1ɑ (F: 5′-CGAGAAGCGGGAGTCTGAAAG-3′, R: 5′-GAGCAGCGAAAGCGTCACA-3′) cDNA. The relative mRNA expression of SIRT-1 and PGC-1ɑ was calculated using the 2^-ΔΔCt formula. All results were normalized to the GAPDH expression level.

For tissue-specific gene expression analysis, samples of shoots, roots, stems, and flowers were collected from 8-month-old adult C. morifolium of the cultivar ‘xiaoyangju’ planted in natural conditions in Tongxiang, China.
For qRT-PCR, a pair of specific primers (qCmUVR8-F and qCmUVR8-R) were designed. qRT-PCR was performed using a MyiQ Single Color Real-time PCR system (Bio-Rad, Hercules, CA, United States) with a SYBR Green Master Mix (CoWin Biotech, Beijing, China), following manufacturer instructions. The procedures for PCR were as follows: 95°C for 10 min; 95°C for 15 s, 40 cycles; 60°C for 60 s. For tissue-specific gene expression analysis, the CmTubulin gene was used as the internal reference. Relative fold changes were calculated basing on comparative cycle threshold (2^-ΔΔC_t) values. For expression analysis of UV-B-induced genes, the AtActin 2 gene was used as the internal reference. All the experiments were repeated three times. Semi-quantitative RT-PCR analysis was performed using qCmUVR8-F and qCmUVR8-R as primers.

RNA was isolated from liver tissues and cells using Trizol (Invitrogen). The isolated RNA was then reverse transcribed into cDNA using reverse transcriptase with either miRNA-specific stem-loop primers (RiboBio, Guangzhou, China) or oligo dT primers (Thermo, Waltham, MA, USA). Differential qRT-PCR was performed on an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) using SYBR Green master mix (CoWin Biotech, Beijing, China). The relative abundance of miRNA was normalized to the small nuclear RNA U6, and the expression levels of the genes were normalized to the endogenous reference gene glyceraldehyde phosphate dehydrogenase. The relative amounts of the miRNAs and genes were measured using the 2^-△△Ct method. All of the qRT-PCR reactions were conducted in triplicate, and the primers used for the qRT-PCR are shown in Table 2.

Total RNA was isolated using TRIZOL reagent (Invitrogen, Cat# 15596018). cDNA was generated using the SuperScript II First-Strand cDNA Synthesis kit (TianGen Biotech, Cat# KR116). qRT-PCR was conducted in duplicate using a SYBR Green Master Mix (CoWin Biosciences, Cat# CW0957H) on a Bio-Rad CFX Maestro (BIO-RAD) or a Light Cycler 480® (Roche). Relative mRNA levels were normalized to GAPDH or actin mRNA levels in each sample. Relative expression changes were calculated by the 2^−ΔΔCt method. Data are shown as the mRNA abundance relative to control groups. All qRT-PCR assays were repeated at least three times, the results of other two repeated experiments are shown in Fig. S12. The primers used were synthesized by Tsingke Biological Technology Company, and the sequences are listed in Supplementary Table1.

Total RNA from samples was extracted using RNeasy plant mini kits (Qiagen, Hilden, Germany) following the manufacturer's protocol, and digested with DNase I to remove genomic DNA contamination. First strand cDNA was prepared using M-MLV reverse transcriptase (CoWin Biotech, Beijing, China) according to the manufacturer's instructions. The gene-specific primers sequences of qRT-PCR were designed using Primer Premier 5 software (PREMIER Biosoft International, Palo Alto, CA) and are shown in Table S1. Triplicate quantitative assays were performed on 1 μl of each cDNA dilution using SYBR Green Master Mix (CoWin Biotech, Beijing, China) with a MyiQ Single Color Real-time PCR system (Bio-Rad, Hercules, CA, USA), according to the manufacturer's protocol. The procedures for PCR were as follows: 95°C for 10 min; 40 cycles of 95°C for 15 s, and 60°C for 60 s. The expression level of the MtActin (MTR_2g008050) gene was used as the endogenous control to calculate relative fold differences based on comparative cycle threshold (2^−ΔΔCt) values. All the experiments were repeated five times. For data statistical analysis, a given fold change value (two-fold) in the expression levels is used to clarify the significant differences among the control and the treatments.