Pad block it dest vector

To construct adenoviral vectors expressing short hairpin interfering RNAs (shRNAs) against pig GPX4 or SELS, three short hairpin oligonucleotides and complementary strands were designed to target pig GPX4 and SELS, respectively. Briefly, the top and bottom strand oligonucleotides were annealed and ligated into the Gateway-based pENTR/U6 vector (Thermofisher) and sequence confirmed. Then pENTR/U6-shRNA plasmids were recombined with the Gateway based pAd-BLOCK-iT DEST vector (Thermofisher) to generate pAd shRNA vector. The pAd shRNA plasmids were then transfected into HEK 293A cells (Invitrogen, Carlsbad, CA, United States) to generate adenovirus, after Pac I digestion. Adenovirus were then amplified HEK 293A cell, and the knockdown efficiency of the shRNA were examined in IPEC-J2 cells with multiplicity of infection (MOI) of 50 (Supplementary Figure 2). The sequence of shRNAs used in this study were GGAATTCTCAGCCAAGGACATC for GPX4 and GGAACCTGATGTTGTTGTTAA for SELS. Sequence of GCTACACAAATCAGCGATTT for shLacz was used as the control. For gene knockdown study, IPEC-J2 cells were infected with shLacz cloned adenovirus (AdshLacz) or shGPX4 cloned adenovirus (AdshGPX4) or shSELS cloned adenovirus (AdshSELS) at MOI of 50 for 48 h.

Primary mouse hepatocytes were isolated as described previously^{69 (link)}. For adenoviral transduction, shRNA oligonucleotides were cloned into pENTR/U6 vector followed by the recombination with pAd/BLOCK-it-DEST vector (Thermo). The targeted sequences of shRNAs were designed as follows. Control: 5′-GTCTCCACGCGCAGTACATTT-3′, FoxO1: 5′-GCATGTTTATTGAGCGCTTGG-3′, NR5A2(LRH1): 5′-ACACAGAAGTCGCGTTCAAC-3′, CtBP2: 5′-GGGAAGACTAGGACGTGATTA-3′, and 5′-GCCACATTCTCAATCTGTATC-3′. Forkhead response element (FHRE) luciferase (Addgene, Cambridge, MA) was cloned into pAd/PL-DEST vector (Thermo). Adenovirus encoding renilla luciferase was purchased from Vector Biolabs (Philadelphia, PA). Adenoviruses were amplified in HEK293A (R70507, Thermo) cells and purified by CsCl gradient centrifugation. FoxO transcriptional activity was measured in primary hepatocytes following transduction with adenoviruses expressing FHRE luciferase and renilla luciferase for 24 h. Cells were lysed and analyzed using Dual-Glo luciferase reporter system (Promega). Firefly luciferase signal was normalized to renilla luciferase.

A sequence predicted to target both mouse and rat Rnf145 and confer effective silencing (5’-GACGAAGCAGATCTGGCTC-3’) was cloned into pENTR/pTER+ (Addgene, 430–1) and subsequently transferred into pAd/BLOCK-iT™-DEST vector using gateway recombination (Invitrogen). Adenoviral particles were produced by transfecting PacI linearized plasmid into HEK293AD cells as previously reported [14 (link)], and subsequently amplified and titered (Viraquest, USA).