λ-DNA (Roche) was stained with YOYO-1 (Invitrogen) at a ratio of 1 dye per 20 base pairs for 48 hours at 4 °C in 0.5× TBE buffer (pH 8). The contour length of unstained λ-DNA (48.5 kbp) is around 16 μm, which increases somewhat after staining47 (link). T4 DNA ligase (Roche) had a final concentration of 40 units/ml in a 0.5× TBE buffer (pH 8) that was modified as follows. In order to obtain catalytically active ligase, 1 mM ATP (Roche) and 5 mM MgCl2 were added as T4 DNA ligase cofactors to catalytically active solutions. This solution was incubated for 1 hour at 16 °C to allow full equilibrization of Mg2+, ATP, and T4 DNA ligase. After this incubation the free Mg2+ concentration was lowered by adding 2 mM EDTA. This is necessary since YOYO-1 is not a stable intercalator at a free Mg2+ concentration of 5 mM. Stained DNA was added to the protein yield a final concentration of 5 μg/mL followed by stabilization for 2 hours at 25 °C. Tests using alternative DNA (human genomic DNA from Roche) and an alternative enzyme provider (New England Biolabs) were conducted to exclude possible contamination. In a subset of experiments, a high concentration (0.6 mg/ml) bovine serum albumin (BSA) was added to prevent sticking to the nanochannel walls.
T4 dna ligase
Manufactured by Roche
Sourced in Germany, United States, Switzerland
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in double-stranded DNA. It is derived from the T4 bacteriophage and is commonly used in molecular biology and genetic engineering applications for the ligation of DNA fragments.
Automatically generated - may contain errors
Lab products found in correlation
Restriction enzymes, by Roche (8 mentions)
Dpnii, by New England Biolabs (7 mentions)
Qiaquick gel extraction kit, by Qiagen (6 mentions)
Restriction enzyme, by New England Biolabs (6 mentions)
Restriction endonucleases, by Roche (5 mentions)
Qiaprep spin miniprep kit, by Qiagen (5 mentions)
Neb 5 alpha competent e coli, by New England Biolabs (5 mentions)
High pure pcr product purification kit, by Roche (5 mentions)
Qiaquick pcr purification kit, by Qiagen (4 mentions)
Csp6i, by Thermo Fisher Scientific (4 mentions)
Ecori hf, by New England Biolabs (4 mentions)
Antarctic phosphatase, by New England Biolabs (3 mentions)
T4 dna ligase, by Thermo Fisher Scientific (3 mentions)
Qiaprep spin plasmid miniprep kit, by Qiagen (3 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (3 mentions)
Bamhi, by Roche (3 mentions)
Kanamycin lb agar plates, by Teknova (3 mentions)
Immedia growth medium with kanamycin, by Thermo Fisher Scientific (3 mentions)
Methyl green pyronin mgp, by Merck Group (2 mentions)
Dpni, by Roche (2 mentions)
102 protocols using t4 dna ligase
1
Visualizing Stained λ-DNA Ligation
2
Adaptor Ligation to MseI Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adaptors were ligated to the MseI digested genomic fragments as described previously
[40 (link)]. Briefly, 5 μM of each primer (MseLig 21: 5′-AGT GGG ATT CCG CAT GCT AGT-3′, MseLig 12: 5′-TAA CTA GCA TGC-3′, IDT DNA), 0.5× One-Phor-All plus Buffer (Pharmacia Biotech) and 1.5 μL of nuclease-free water were added to the sample. Annealing was initiated at 65°C for 1 min, and the temperature was ramped at 1°C/min down to 15°C. T4 DNA ligase (5 units, Boehringer Mannheim) and 10 nmol of ATP were added and the reaction and incubated for 16 h at 15°C.
[40 (link)]. Briefly, 5 μM of each primer (MseLig 21: 5′-AGT GGG ATT CCG CAT GCT AGT-3′, MseLig 12: 5′-TAA CTA GCA TGC-3′, IDT DNA), 0.5× One-Phor-All plus Buffer (Pharmacia Biotech) and 1.5 μL of nuclease-free water were added to the sample. Annealing was initiated at 65°C for 1 min, and the temperature was ramped at 1°C/min down to 15°C. T4 DNA ligase (5 units, Boehringer Mannheim) and 10 nmol of ATP were added and the reaction and incubated for 16 h at 15°C.
3
Genomic Library Construction from Salmonella Typhi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomal DNA was prepared from S. Typhi STM1 cells by using an
Ultra Clean DNA Isolation Kit (MO-BIO, USA). The DNA was partially digested with
Sau3AI, and fragments of between 1 and 10 kbp were separated by
electrophoresis in 0.5% agarose gels and then purified by a Qiaquick Gel Extraction
Kit (Qiagen, USA). The DNA fragments were ligated to pUC19 (digested with
BamHI and dephosphorylated with bacterial alkaline phosphatase)
with T4 DNA ligase (Boehringer Mannheim GmbH., Germany). Competent
Escherichia coli DH5α cells, transformed with the recombinant
plasmids, were spread on LB agar plates containing 0.5 μg/mL of ciprofloxacin and 100
μg/mL of ampicillin. The plates were incubated under aerobic conditions at 37°C for
24 h and the colonies formed were collected. Plasmid-containing transformants were
isolated, reintroduced into E. coli DH5α cells, and the
transformation mixture was spread onto LB agar plates. The plates were incubated at
37°C for 24 h. Plasmids from the transformants were isolated.
Ultra Clean DNA Isolation Kit (MO-BIO, USA). The DNA was partially digested with
Sau3AI, and fragments of between 1 and 10 kbp were separated by
electrophoresis in 0.5% agarose gels and then purified by a Qiaquick Gel Extraction
Kit (Qiagen, USA). The DNA fragments were ligated to pUC19 (digested with
BamHI and dephosphorylated with bacterial alkaline phosphatase)
with T4 DNA ligase (Boehringer Mannheim GmbH., Germany). Competent
Escherichia coli DH5α cells, transformed with the recombinant
plasmids, were spread on LB agar plates containing 0.5 μg/mL of ciprofloxacin and 100
μg/mL of ampicillin. The plates were incubated under aerobic conditions at 37°C for
24 h and the colonies formed were collected. Plasmid-containing transformants were
isolated, reintroduced into E. coli DH5α cells, and the
transformation mixture was spread onto LB agar plates. The plates were incubated at
37°C for 24 h. Plasmids from the transformants were isolated.
4
Construction of pSaMe-Ta61A Expression Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 18
Expression vector pSaMe-Ta61 was constructed by digesting plasmid pMJ09 (WO 2005/056772), which harbors the amdS selectable marker, with Nsi I, which liberated a 2.7 kb amdS fragment. The 2.7 kb amdS fragment was then isolated by 1.0% agarose gel electrophoresis using TAE buffer and purified using a QIAQUICK® Gel Extraction Kit.
Expression vector pCW087 was digested with Nsi I and a 4.7 kb fragment was isolated by 1.0% agarose gel electrophoresis using TAE buffer and purified using a QIAQUICK® Gel Extraction Kit. The 2.7 kb amdS fragment was then ligated to the 4.7 kb vector fragment, using T4 DNA ligase (Roche, Indianapolis, Ind., USA) according to manufacturer's protocol, to create the expression vector pSaMe-Ta61A. Plasmid pSaMe-Ta61A comprises the Trichoderma reesei cellobiohydrolase I (CEL7A) gene promoter and terminator operably linked to the Thermoascus aurantiacus GH61A mature coding sequence.
5
Construction of pSMai140 Expression Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 7
Expression vector pSMai140 was constructed by digesting plasmid pSATe111BG41 (WO 04/099228), which carries the Aspergillus oryzae beta-glucosidase variant BG41 full-length coding region (SEQ ID NO: 25, which encodes the amino acid sequence of SEQ ID NO: 26), with Nco I. The resulting 1243 bp fragment was isolated by 1.0% agarose gel electrophoresis using TAE buffer and purified using a QIAQUICK® Gel Extraction Kit according to the manufacturer's instructions.
Expression vector pSMai135 was digested with Nco I and a 8286 bp fragment was isolated by 1.0% agarose gel electrophoresis using TAE buffer and purified using a QIAQUICK® Gel Extraction Kit according to the manufacturer's instructions. The 1243 bp Nco I digested Aspergillus oryzae beta-glucosidase variant BG41 fragment was then ligated to the 8286 bp vector fragment, using T4 DNA ligase (Roche, Indianapolis, Ind., USA) according to manufacturer's protocol, to create the expression vector pSMai140 (
6
3C Assay for Chromatin Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3C analyses were performed as previously reported (35) . Briefly, 1x10 7 B16F0 mouse melanoma or NIH3T3-L929 mouse fibroblast cells were fixed in 2% PFA/PBS. After quenching, cells were resuspended in 500 l lysis buffer (10 mM Tris HCl, 10 mM NaCl, 0.3% NP40, 1x Roche Complete) and kept on ice. Methyl Green-Pyronin (MGP, Sigma Aldrich) was used to monitor the release of intact nuclei. Chromatin was digested overnight with 300 U DpnII (NEB) at 37C. After enzyme inactivation, chromatin was ligated overnight with 45 Weiss Units of T4 DNA ligase (Promega) in 7 ml ligation buffer (30 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, 1 mM ATP). Finally, the sample was treated with Proteinase K and RNase A. DNA was extracted by phenol-chloroform and resuspended in 150 l TE (10 mM Tris-HCl, 1 mM EDTA). To generate control libraries as a standard for qPCR, 1 g of BAC RP24-276I14 and equimolar amount of BAC RP23-359C16 were mixed, digested with 50 U of DpnI (Roche) and religated with T4 DNA ligase.
7
Engineered HEV ORF2 Capsid Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid pET-28a (+)/p179 containing the 439–617aa region of HEV ORF2 of genotype 4 HEV strain has been constructed previously in our laboratory14 (link),28 (link). The p179 mutants with wild-type asparagine (N) replaced by the cyclic aa (P) and aromatic aa (Y) at position 562 were previously designed and successfully expressed in P. pastoris14 (link). HEV capsid protein-specific mAb (1G10) was produced by our research group13 (link). Isopropyl-β-D-thiogalactopyranoside (IPTG), High-fidelity DNA polymerase, dNTP, T4 DNA ligase and restriction endonucleases were purchased from Roche (Germany). E. coli BL21(DE3) cells were purchased from Promega. HRP-conjugated goat anti-mouse was from KPL (Gaithersburg, MD, USA). Trypsin and DAB were purchased from Sigma–Aldrich (St. Louis, MO, USA). Plasmid and DNA recovery/purification kits were obtained from Axygen, Inc (USA). The nickel-nitrilotriacetic acid (Ni-NTA) Agarose was obtained from QIAGEN Sciences, MD, USA.
8
Construction of Metagenomic Libraries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The construction of metagenomic libraries and their subsequent amplification was accomplished as previously described (Mirete et al., 2007 (link); González-Pastor and Mirete, 2010 ). Briefly, the metagenomic DNA was partially digested using Sau3AI, and fragments from 1 to 8 kb were collected directly from a 0.8% low-melting-point agarose gel with the QIAquick extraction gel (QIAGEN) for ligation into the dephosphorylated and BamHI-digested pSKII+ vector. DNA (100 ng) excised from the gel was mixed with the vector at a molar ratio of 1:1. Ligation mixtures were incubated overnight at 16°C using T4 DNA ligase (Roche) and used to transform E. coli DH10B cells (Invitrogen) by electroporation with a Micropulser (Bio-Rad) according to the manufacturer’s instructions.
9
Construction of pTarget GLuc-Δ1D2A Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pTarget GLuc-Δ1D2A plasmid vector was constructed as previously described (22 (link)). Amplification of the 3C protease gene from an FMDV Asia1 Lebanon 1989 (GenBank accession no. AY593798 ) noninfectious template was performed using OneTaq 2× master mix with Standard Buffer (New England BioLabs) and primers XmaI-3C-F (CTACCCGGGCCGAGTGGTGCCCCAC) and 3C-NotI-R (TAGCGGCCGCTACTCGTGGTGTGGTTC). The PCR product was purified using a PCR purification kit (Qiagen). Both the PCR product and pTarget GLuc-Δ1D2A vector were digested with XmaI and NotI-HF restriction enzymes (New England BioLabs). Ligations were performed using T4 DNA ligase (Roche) and transformed into NEB 5-alpha competent E. coli (New England BioLabs). Plasmids were isolated using a QIAprep Spin Mini-prep kit (Qiagen) and were amplified with primers T7 (TAATACGACTCACTATAGGG) and Seq-R (TTACGCCAAGTTATTTAGGTGACA) for sequencing, and results were analyzed with Sequencher 4.8 software (Genecodes).
10
Cloning and Fusion of ORF2-NSP4 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The truncated ORF2 gene was separated from PBlueScript II SK (+) and was amplified using the following primers: ORF2 Forward: 5-CTCGAGGGATCCA TGGCC-3 and ORF2 Reverse: 5-ACGCGTCGAC GGCCAGCACGGAGTGTGGA-3. The ORF2 forward and reverse primers contain BamHI and SalI restriction sites (underlined), respectively. Then the truncated ORF2 gene was inserted into the linearized pfast Back 1 and then transformed in E.coli DH5α. Then the selected colonies cultured on Luria Bertani medium (LB) (Merck, Germany) agar plate containing ampicillin (50 mg/L).
The pBlue Script II containing fusion truncated ORF2-NSP4 was transformed in E.coli DH5α, cultured in LB agar containing ampicillin (50 mg/L), then plasmid was extracted and double digested by BamHI and SalI restriction enzymes (Thermo Scientific, USA). Simultaneously, PfastBac1 plasmid was also double digested by BamHI and Sal1. To confirm digestion, the products were run on the agarose gel. Then, truncated ORF2-NSP4 and linearized PfastBac1 were extracted by using the agarose gel DNA extraction kit (Roche, Germany) and ligated using the T4 DNA ligase (Roche, Germany). The recombinant PfastBac1 + truncated ORF2-NSP4 was transformed in to E.coli DH5α competent cells using CaCl2 and colonies were selected on LB agar plate containing ampicillin (50 mg/L).
The pBlue Script II containing fusion truncated ORF2-NSP4 was transformed in E.coli DH5α, cultured in LB agar containing ampicillin (50 mg/L), then plasmid was extracted and double digested by BamHI and SalI restriction enzymes (Thermo Scientific, USA). Simultaneously, PfastBac1 plasmid was also double digested by BamHI and Sal1. To confirm digestion, the products were run on the agarose gel. Then, truncated ORF2-NSP4 and linearized PfastBac1 were extracted by using the agarose gel DNA extraction kit (Roche, Germany) and ligated using the T4 DNA ligase (Roche, Germany). The recombinant PfastBac1 + truncated ORF2-NSP4 was transformed in to E.coli DH5α competent cells using CaCl2 and colonies were selected on LB agar plate containing ampicillin (50 mg/L).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!